Incidental Mutation 'R3882:Eif3f'
ID312818
Institutional Source Beutler Lab
Gene Symbol Eif3f
Ensembl Gene ENSMUSG00000031029
Gene Nameeukaryotic translation initiation factor 3, subunit F
SynonymsEif3s5, 0610037M02Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R3882 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108934417-108942951 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108940955 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 319 (V319A)
Ref Sequence ENSEMBL: ENSMUSP00000033342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033342]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033342
AA Change: V319A

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000033342
Gene: ENSMUSG00000031029
AA Change: V319A

DomainStartEndE-ValueType
low complexity region 2 93 N/A INTRINSIC
JAB_MPN 95 225 3.11e-42 SMART
Pfam:MitMem_reg 247 359 7e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153596
Meta Mutation Damage Score 0.2633 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,262,700 W24R probably damaging Het
Acy1 G T 9: 106,435,509 T181K possibly damaging Het
Adcy4 A G 14: 55,774,546 F581L probably benign Het
Amhr2 G A 15: 102,445,898 G48D probably damaging Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Arhgef17 A G 7: 100,876,454 F1979S possibly damaging Het
C2 T C 17: 34,873,489 T191A probably benign Het
Cmya5 T A 13: 93,091,219 T2454S probably benign Het
Dstn A G 2: 143,942,187 E150G probably benign Het
Dync1h1 G T 12: 110,629,058 V1444F probably benign Het
Gpha2 T C 19: 6,226,889 probably null Het
Hps5 A G 7: 46,771,996 V648A possibly damaging Het
Jup A G 11: 100,378,381 V402A probably benign Het
Kif18a A G 2: 109,306,974 N517S probably benign Het
Kif20b T A 19: 34,950,080 I874N probably damaging Het
Lepr T A 4: 101,815,265 V1162E probably damaging Het
Man2a2 A T 7: 80,362,315 V698D possibly damaging Het
Miip A C 4: 147,861,052 S376A possibly damaging Het
Nsun7 G A 5: 66,278,640 R285Q probably damaging Het
Nup210l T C 3: 90,124,210 V281A probably benign Het
Paxip1 C T 5: 27,748,839 R953Q probably damaging Het
Pcdha8 C A 18: 36,993,046 L194I probably damaging Het
Pcdha8 A G 18: 36,993,571 I369V probably benign Het
Pcdhga10 C A 18: 37,747,441 A85E possibly damaging Het
Ppfibp1 A G 6: 146,998,221 R137G possibly damaging Het
Rcor1 C T 12: 111,103,753 A230V probably damaging Het
Scn3a T C 2: 65,482,279 M1191V probably benign Het
Skor2 A G 18: 76,862,689 D904G probably damaging Het
Suco A T 1: 161,834,744 V706E probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Vmn1r83 A T 7: 12,321,402 C243S probably damaging Het
Wdr17 A T 8: 54,639,501 C1083S possibly damaging Het
Zfp952 G T 17: 33,001,975 E18* probably null Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Zscan25 G T 5: 145,291,052 G509C probably damaging Het
Other mutations in Eif3f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02690:Eif3f APN 7 108934718 missense probably damaging 1.00
IGL02821:Eif3f APN 7 108934674 unclassified probably benign
IGL02821:Eif3f APN 7 108934675 unclassified probably benign
R0010:Eif3f UTSW 7 108941005 missense possibly damaging 0.93
R1054:Eif3f UTSW 7 108937817 critical splice donor site probably null
R1886:Eif3f UTSW 7 108940751 missense probably benign 0.08
R2877:Eif3f UTSW 7 108934812 splice site probably null
R3700:Eif3f UTSW 7 108940275 missense probably benign 0.23
R4471:Eif3f UTSW 7 108940946 missense possibly damaging 0.79
R4472:Eif3f UTSW 7 108940946 missense possibly damaging 0.79
R4817:Eif3f UTSW 7 108937775 missense probably damaging 0.99
R4953:Eif3f UTSW 7 108934640 unclassified probably benign
R5744:Eif3f UTSW 7 108938417 missense probably damaging 0.99
R7162:Eif3f UTSW 7 108940731 missense probably benign 0.02
R7235:Eif3f UTSW 7 108938088 missense possibly damaging 0.78
R7445:Eif3f UTSW 7 108934658 missense unknown
Predicted Primers PCR Primer
(F):5'- ACAGTATGCTGAGGATGTGCTG -3'
(R):5'- TGAGTCTAGTTAACAAGTCATGGC -3'

Sequencing Primer
(F):5'- CTGAGGATGTGCTGGTGAGAATTG -3'
(R):5'- GGCAATACCAGTAGTACTTCAGTC -3'
Posted On2015-04-30