Incidental Mutation 'R0386:Aasdh'
ID 31282
Institutional Source Beutler Lab
Gene Symbol Aasdh
Ensembl Gene ENSMUSG00000055923
Gene Name aminoadipate-semialdehyde dehydrogenase
Synonyms A230062G08Rik
MMRRC Submission 038592-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.159) question?
Stock # R0386 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 77021506-77053361 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 77044308 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 194 (V194A)
Ref Sequence ENSEMBL: ENSMUSP00000113792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069709] [ENSMUST00000120963] [ENSMUST00000123682] [ENSMUST00000126741] [ENSMUST00000146570]
AlphaFold Q80WC9
Predicted Effect probably damaging
Transcript: ENSMUST00000069709
AA Change: V194A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069279
Gene: ENSMUSG00000055923
AA Change: V194A

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000120963
AA Change: V194A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113792
Gene: ENSMUSG00000055923
AA Change: V194A

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000123682
AA Change: V194A

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121050
Gene: ENSMUSG00000055923
AA Change: V194A

DomainStartEndE-ValueType
Pfam:AMP-binding 7 231 1.7e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000126741
AA Change: V194A

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118854
Gene: ENSMUSG00000055923
AA Change: V194A

DomainStartEndE-ValueType
Pfam:AMP-binding 7 403 7.5e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136080
Predicted Effect possibly damaging
Transcript: ENSMUST00000146570
AA Change: V194A

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117639
Gene: ENSMUSG00000055923
AA Change: V194A

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 2.1e-58 PFAM
Pfam:PP-binding 556 628 1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154548
Meta Mutation Damage Score 0.6367 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: The gene product is a cytosolic enzyme involved in the production of alpha-aminoadipic acid from alpha-aminoadipic semialdehyde. It is postulated that this enzyme plays a role in lysine metabolism. There is currently debate regarding this enzyme's putative requirement of pyrroloquinoline quinine as an essential cofactor. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 G A 2: 26,876,691 (GRCm39) probably null Het
Ahnak T C 19: 8,988,508 (GRCm39) M3264T possibly damaging Het
Birc6 T A 17: 74,906,335 (GRCm39) C1409S probably damaging Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Dnah2 A G 11: 69,338,687 (GRCm39) V3161A probably damaging Het
Dnah5 A T 15: 28,383,727 (GRCm39) Y2983F probably damaging Het
Dnah6 G A 6: 73,060,107 (GRCm39) L2774F probably damaging Het
Dst A T 1: 34,256,917 (GRCm39) T4398S probably damaging Het
Efcab5 G A 11: 77,031,749 (GRCm39) R42W probably damaging Het
Efcab5 A T 11: 77,063,204 (GRCm39) M96K probably benign Het
Elavl4 A G 4: 110,063,902 (GRCm39) probably benign Het
Flt4 G A 11: 49,535,213 (GRCm39) A1214T probably benign Het
Fn1 G T 1: 71,634,945 (GRCm39) T2127N probably damaging Het
Foxj1 A T 11: 116,222,629 (GRCm39) S391R possibly damaging Het
Gabrb1 A T 5: 72,266,150 (GRCm39) Y269F probably damaging Het
Ghitm A G 14: 36,847,868 (GRCm39) S259P possibly damaging Het
Gm16332 A G 1: 139,851,928 (GRCm39) noncoding transcript Het
Gm16380 T A 9: 53,791,727 (GRCm39) noncoding transcript Het
Gm9869 A T 9: 60,745,344 (GRCm39) probably benign Het
Gm9936 G A 5: 114,995,192 (GRCm39) Q142* probably null Het
Hmbs T C 9: 44,248,305 (GRCm39) Y260C probably benign Het
Hoxc5 T A 15: 102,923,784 (GRCm39) C193* probably null Het
Idh2 C T 7: 79,748,005 (GRCm39) A232T probably damaging Het
Lce1j T C 3: 92,696,695 (GRCm39) K28E unknown Het
Lpgat1 C T 1: 191,451,460 (GRCm39) probably benign Het
Lyst T C 13: 13,882,799 (GRCm39) probably benign Het
Megf11 A G 9: 64,547,360 (GRCm39) N235D probably damaging Het
Mst1r T A 9: 107,794,003 (GRCm39) probably null Het
Nr2c2ap A G 8: 70,584,237 (GRCm39) D9G probably benign Het
Obscn T C 11: 59,027,165 (GRCm39) T13A probably damaging Het
Ofcc1 A C 13: 40,367,950 (GRCm39) L188* probably null Het
Oma1 A T 4: 103,182,398 (GRCm39) probably benign Het
Or10aa3 A T 1: 173,877,965 (GRCm39) T9S probably benign Het
Or5m11 A G 2: 85,782,217 (GRCm39) E270G probably damaging Het
Pcm1 T C 8: 41,769,060 (GRCm39) F1642S probably damaging Het
Pglyrp2 A G 17: 32,639,836 (GRCm39) M1T probably null Het
Pnpla5 G T 15: 84,004,920 (GRCm39) L144M probably damaging Het
Prdm10 C A 9: 31,227,596 (GRCm39) T67K probably damaging Het
Ralgapa1 A T 12: 55,754,852 (GRCm39) H1193Q probably benign Het
Sall1 A G 8: 89,759,232 (GRCm39) S291P probably damaging Het
Sdk2 T C 11: 113,784,290 (GRCm39) T150A probably damaging Het
Sel1l2 T A 2: 140,117,361 (GRCm39) Y170F probably benign Het
Sema4a C T 3: 88,344,107 (GRCm39) V715I possibly damaging Het
Smgc G A 15: 91,738,841 (GRCm39) A500T probably benign Het
Spef2 A G 15: 9,584,148 (GRCm39) V1639A probably damaging Het
Srrm4 A G 5: 116,620,437 (GRCm39) probably benign Het
Tbc1d23 G A 16: 57,009,636 (GRCm39) H418Y probably damaging Het
Tbk1 A G 10: 121,420,159 (GRCm39) L10P probably damaging Het
Thumpd3 G A 6: 113,042,621 (GRCm39) probably null Het
Trp53bp1 G T 2: 121,035,424 (GRCm39) T1609K probably damaging Het
Tut1 A G 19: 8,932,919 (GRCm39) N84S probably benign Het
Urb1 C T 16: 90,593,287 (GRCm39) G282R probably damaging Het
Usp19 A T 9: 108,376,910 (GRCm39) D1160V probably damaging Het
Usp9y A G Y: 1,316,933 (GRCm39) V1872A probably damaging Het
Zfp276 C A 8: 123,986,242 (GRCm39) Y386* probably null Het
Other mutations in Aasdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Aasdh APN 5 77,026,381 (GRCm39) unclassified probably benign
IGL01013:Aasdh APN 5 77,034,053 (GRCm39) missense possibly damaging 0.68
IGL01558:Aasdh APN 5 77,036,464 (GRCm39) missense possibly damaging 0.89
IGL02544:Aasdh APN 5 77,049,961 (GRCm39) missense probably benign 0.27
IGL02614:Aasdh APN 5 77,044,215 (GRCm39) splice site probably benign
IGL02678:Aasdh APN 5 77,035,867 (GRCm39) splice site probably benign
IGL02739:Aasdh APN 5 77,026,364 (GRCm39) missense possibly damaging 0.64
IGL02947:Aasdh APN 5 77,049,957 (GRCm39) missense probably benign 0.01
IGL03116:Aasdh APN 5 77,049,936 (GRCm39) splice site probably null
IGL03398:Aasdh APN 5 77,039,566 (GRCm39) missense probably benign 0.02
1mM(1):Aasdh UTSW 5 77,044,464 (GRCm39) missense possibly damaging 0.91
R0183:Aasdh UTSW 5 77,034,082 (GRCm39) missense probably benign 0.05
R0226:Aasdh UTSW 5 77,049,849 (GRCm39) missense probably damaging 1.00
R0367:Aasdh UTSW 5 77,049,961 (GRCm39) missense probably damaging 0.99
R0529:Aasdh UTSW 5 77,024,114 (GRCm39) nonsense probably null
R0881:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R0882:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1033:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1034:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1035:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1036:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1366:Aasdh UTSW 5 77,036,651 (GRCm39) missense probably benign 0.10
R1446:Aasdh UTSW 5 77,034,136 (GRCm39) missense probably benign 0.45
R1449:Aasdh UTSW 5 77,034,136 (GRCm39) missense probably benign 0.45
R1469:Aasdh UTSW 5 77,039,526 (GRCm39) missense probably damaging 0.97
R1469:Aasdh UTSW 5 77,039,526 (GRCm39) missense probably damaging 0.97
R1583:Aasdh UTSW 5 77,030,528 (GRCm39) missense probably benign 0.00
R1641:Aasdh UTSW 5 77,039,626 (GRCm39) missense probably benign 0.36
R1876:Aasdh UTSW 5 77,025,396 (GRCm39) missense probably damaging 1.00
R1895:Aasdh UTSW 5 77,039,551 (GRCm39) missense probably damaging 1.00
R1946:Aasdh UTSW 5 77,039,551 (GRCm39) missense probably damaging 1.00
R3615:Aasdh UTSW 5 77,036,629 (GRCm39) missense probably benign 0.20
R3616:Aasdh UTSW 5 77,036,629 (GRCm39) missense probably benign 0.20
R3746:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3747:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3748:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3750:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3836:Aasdh UTSW 5 77,026,315 (GRCm39) missense probably benign 0.32
R4857:Aasdh UTSW 5 77,035,131 (GRCm39) missense probably benign 0.01
R4928:Aasdh UTSW 5 77,044,535 (GRCm39) missense possibly damaging 0.65
R4937:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R5762:Aasdh UTSW 5 77,044,445 (GRCm39) missense probably benign 0.00
R5866:Aasdh UTSW 5 77,024,058 (GRCm39) missense probably damaging 1.00
R5940:Aasdh UTSW 5 77,030,745 (GRCm39) missense probably benign 0.07
R6253:Aasdh UTSW 5 77,034,105 (GRCm39) missense possibly damaging 0.81
R6542:Aasdh UTSW 5 77,030,902 (GRCm39) missense probably damaging 1.00
R6825:Aasdh UTSW 5 77,036,696 (GRCm39) splice site probably null
R6868:Aasdh UTSW 5 77,039,527 (GRCm39) missense probably damaging 0.99
R6876:Aasdh UTSW 5 77,044,288 (GRCm39) missense probably damaging 1.00
R6961:Aasdh UTSW 5 77,024,148 (GRCm39) missense probably damaging 1.00
R6963:Aasdh UTSW 5 77,044,303 (GRCm39) missense probably damaging 0.99
R7069:Aasdh UTSW 5 77,024,203 (GRCm39) missense probably benign 0.03
R7220:Aasdh UTSW 5 77,049,772 (GRCm39) missense probably benign 0.13
R7545:Aasdh UTSW 5 77,027,861 (GRCm39) missense probably damaging 1.00
R7673:Aasdh UTSW 5 77,030,555 (GRCm39) missense probably benign 0.03
R7703:Aasdh UTSW 5 77,035,924 (GRCm39) missense probably damaging 0.99
R7890:Aasdh UTSW 5 77,031,969 (GRCm39) missense probably benign 0.19
R7978:Aasdh UTSW 5 77,036,515 (GRCm39) missense probably damaging 0.99
R8046:Aasdh UTSW 5 77,044,325 (GRCm39) missense probably benign
R8152:Aasdh UTSW 5 77,044,305 (GRCm39) missense probably damaging 1.00
R8425:Aasdh UTSW 5 77,034,124 (GRCm39) missense possibly damaging 0.49
R8884:Aasdh UTSW 5 77,039,641 (GRCm39) missense possibly damaging 0.94
R9028:Aasdh UTSW 5 77,023,977 (GRCm39) missense probably damaging 1.00
R9361:Aasdh UTSW 5 77,030,225 (GRCm39) missense probably benign 0.01
R9519:Aasdh UTSW 5 77,030,572 (GRCm39) missense probably benign 0.00
Z1088:Aasdh UTSW 5 77,049,004 (GRCm39) splice site probably null
Z1176:Aasdh UTSW 5 77,039,643 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCACAGGTGAGCCTTTACCCATCG -3'
(R):5'- CCTGGCACTCTTCAGACTGCATTG -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- CTTCAGACTGCATTGGGAAGATG -3'
Posted On 2013-04-24