Incidental Mutation 'R3882:Zfp952'
ID312829
Institutional Source Beutler Lab
Gene Symbol Zfp952
Ensembl Gene ENSMUSG00000053390
Gene Namezinc finger protein 952
SynonymsC920016K16Rik
Accession Numbers

Genbank: NM_001045559; MGI: 2441928

Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R3882 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location32993129-33005457 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 33001975 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 18 (E18*)
Ref Sequence ENSEMBL: ENSMUSP00000123066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087666] [ENSMUST00000157017]
Predicted Effect probably null
Transcript: ENSMUST00000087666
AA Change: E56*
SMART Domains Protein: ENSMUSP00000084949
Gene: ENSMUSG00000053390
AA Change: E56*

DomainStartEndE-ValueType
KRAB 10 73 4.6e-14 SMART
ZnF_C2H2 251 273 3.44e-4 SMART
ZnF_C2H2 279 301 1.28e-3 SMART
ZnF_C2H2 307 329 1.36e-2 SMART
ZnF_C2H2 335 357 2.75e-3 SMART
ZnF_C2H2 363 385 9.44e-2 SMART
ZnF_C2H2 391 413 1.47e-3 SMART
ZnF_C2H2 419 441 2.91e-2 SMART
ZnF_C2H2 447 469 2.57e-3 SMART
ZnF_C2H2 475 497 1.43e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141815
Predicted Effect probably null
Transcript: ENSMUST00000157017
AA Change: E18*
SMART Domains Protein: ENSMUSP00000123066
Gene: ENSMUSG00000053390
AA Change: E18*

DomainStartEndE-ValueType
Blast:KRAB 1 35 4e-17 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (33/34)
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,262,700 W24R probably damaging Het
Acy1 G T 9: 106,435,509 T181K possibly damaging Het
Adcy4 A G 14: 55,774,546 F581L probably benign Het
Amhr2 G A 15: 102,445,898 G48D probably damaging Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Arhgef17 A G 7: 100,876,454 F1979S possibly damaging Het
C2 T C 17: 34,873,489 T191A probably benign Het
Cmya5 T A 13: 93,091,219 T2454S probably benign Het
Dstn A G 2: 143,942,187 E150G probably benign Het
Dync1h1 G T 12: 110,629,058 V1444F probably benign Het
Eif3f T C 7: 108,940,955 V319A possibly damaging Het
Gpha2 T C 19: 6,226,889 probably null Het
Hps5 A G 7: 46,771,996 V648A possibly damaging Het
Jup A G 11: 100,378,381 V402A probably benign Het
Kif18a A G 2: 109,306,974 N517S probably benign Het
Kif20b T A 19: 34,950,080 I874N probably damaging Het
Lepr T A 4: 101,815,265 V1162E probably damaging Het
Man2a2 A T 7: 80,362,315 V698D possibly damaging Het
Miip A C 4: 147,861,052 S376A possibly damaging Het
Nsun7 G A 5: 66,278,640 R285Q probably damaging Het
Nup210l T C 3: 90,124,210 V281A probably benign Het
Paxip1 C T 5: 27,748,839 R953Q probably damaging Het
Pcdha8 C A 18: 36,993,046 L194I probably damaging Het
Pcdha8 A G 18: 36,993,571 I369V probably benign Het
Pcdhga10 C A 18: 37,747,441 A85E possibly damaging Het
Ppfibp1 A G 6: 146,998,221 R137G possibly damaging Het
Rcor1 C T 12: 111,103,753 A230V probably damaging Het
Scn3a T C 2: 65,482,279 M1191V probably benign Het
Skor2 A G 18: 76,862,689 D904G probably damaging Het
Suco A T 1: 161,834,744 V706E probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Vmn1r83 A T 7: 12,321,402 C243S probably damaging Het
Wdr17 A T 8: 54,639,501 C1083S possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Zscan25 G T 5: 145,291,052 G509C probably damaging Het
Other mutations in Zfp952
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01865:Zfp952 APN 17 33002817 missense probably benign 0.00
IGL02560:Zfp952 APN 17 33002819 nonsense probably null
IGL03056:Zfp952 APN 17 33002766 missense probably damaging 0.98
IGL03151:Zfp952 APN 17 33003008 missense probably benign 0.01
0152:Zfp952 UTSW 17 33003221 splice site probably null
R0508:Zfp952 UTSW 17 33003005 missense possibly damaging 0.90
R1936:Zfp952 UTSW 17 33003669 missense possibly damaging 0.71
R4560:Zfp952 UTSW 17 33003954 missense probably benign 0.33
R4649:Zfp952 UTSW 17 33002925 missense probably damaging 0.99
R7103:Zfp952 UTSW 17 33003632 missense possibly damaging 0.94
R7207:Zfp952 UTSW 17 33003515 missense possibly damaging 0.93
R7209:Zfp952 UTSW 17 33003470 missense possibly damaging 0.71
R7508:Zfp952 UTSW 17 33003782 missense probably benign 0.06
R7699:Zfp952 UTSW 17 33002009 missense possibly damaging 0.53
R8424:Zfp952 UTSW 17 33003217 missense probably benign 0.18
R8445:Zfp952 UTSW 17 33003578 missense possibly damaging 0.78
Z1177:Zfp952 UTSW 17 33003104 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGAACAGCTGCTTCTTGTTC -3'
(R):5'- CCGATCATACCCAGGTTAATAATG -3'

Sequencing Primer
(F):5'- AGAACAGCTGCTTCTTGTTCATTTG -3'
(R):5'- ATTCTGAATATTCCAGCTCAGTGC -3'
Posted On2015-04-30