Incidental Mutation 'R3888:4933407L21Rik'
ID312842
Institutional Source Beutler Lab
Gene Symbol 4933407L21Rik
Ensembl Gene ENSMUSG00000026224
Gene NameRIKEN cDNA 4933407L21 gene
Synonyms
MMRRC Submission 040800-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R3888 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location85928483-85940624 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 85940551 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086975] [ENSMUST00000129392]
Predicted Effect probably benign
Transcript: ENSMUST00000086975
SMART Domains Protein: ENSMUSP00000084196
Gene: ENSMUSG00000049608

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 27 183 9.7e-9 PFAM
Pfam:7tm_1 37 296 2.7e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000129392
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190367
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 A G 1: 155,624,897 D201G probably damaging Het
Adam17 G A 12: 21,325,587 R744C probably damaging Het
Adss A G 1: 177,767,769 Y402H probably damaging Het
Ano3 T A 2: 110,885,000 K31I probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Cmya5 T G 13: 93,093,656 R1641S probably benign Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Frem1 T C 4: 82,913,607 R1991G probably benign Het
Gimap7 G A 6: 48,723,845 E122K probably benign Het
Hps3 A G 3: 20,003,223 probably null Het
Kctd2 A T 11: 115,427,519 K209N probably damaging Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Muc5ac T C 7: 141,791,224 V144A possibly damaging Het
Mypn T C 10: 63,192,510 Y258C probably damaging Het
Ntf3 T C 6: 126,102,442 M21V probably benign Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Olfr1447 A T 19: 12,901,133 C216S probably benign Het
Olfr802 G A 10: 129,682,218 H174Y possibly damaging Het
Olfr802 A T 10: 129,682,219 D173E probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Robo3 G A 9: 37,422,181 Q723* probably null Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Slc12a6 T A 2: 112,267,030 L70Q possibly damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Smim17 G T 7: 6,429,280 G74C probably damaging Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Suv39h2 G A 2: 3,464,808 T170I probably benign Het
Thrb A G 14: 18,033,551 K424R probably damaging Het
Tm4sf4 C T 3: 57,437,745 Q191* probably null Het
Trak1 G T 9: 121,442,797 probably null Het
Ttn A G 2: 76,710,274 S25796P probably damaging Het
Ugp2 T C 11: 21,353,366 R80G probably benign Het
Utp15 C T 13: 98,259,166 V103I probably benign Het
Wdr3 A T 3: 100,153,906 S249T probably benign Het
Zeb1 T A 18: 5,748,743 D86E probably damaging Het
Other mutations in 4933407L21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0308:4933407L21Rik UTSW 1 85931286 intron probably benign
R0458:4933407L21Rik UTSW 1 85929026 missense unknown
R3155:4933407L21Rik UTSW 1 85931383 intron probably benign
R3156:4933407L21Rik UTSW 1 85931383 intron probably benign
R3886:4933407L21Rik UTSW 1 85940551 splice site probably null
R3887:4933407L21Rik UTSW 1 85940551 splice site probably null
R3889:4933407L21Rik UTSW 1 85940551 splice site probably null
R4743:4933407L21Rik UTSW 1 85931251 intron probably benign
R4955:4933407L21Rik UTSW 1 85931287 intron probably benign
R5745:4933407L21Rik UTSW 1 85931274 splice site probably null
R7429:4933407L21Rik UTSW 1 85931307 missense unknown
R8257:4933407L21Rik UTSW 1 85931339 nonsense probably null
R8272:4933407L21Rik UTSW 1 85931397 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTTTCCACACAACCTGCTT -3'
(R):5'- CTGGATGGGTGACAGATGTC -3'

Sequencing Primer
(F):5'- TAATCCTTCTCAGCCCTTAAAAAGC -3'
(R):5'- GACAGATGTCACACTTGTTTTGAG -3'
Posted On2015-04-30