Incidental Mutation 'R3888:Adss'
ID312845
Institutional Source Beutler Lab
Gene Symbol Adss
Ensembl Gene ENSMUSG00000015961
Gene Nameadenylosuccinate synthetase, non muscle
SynonymsAS
MMRRC Submission 040800-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3888 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location177762962-177796511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 177767769 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 402 (Y402H)
Ref Sequence ENSEMBL: ENSMUSP00000016105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016105]
Predicted Effect probably damaging
Transcript: ENSMUST00000016105
AA Change: Y402H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016105
Gene: ENSMUSG00000015961
AA Change: Y402H

DomainStartEndE-ValueType
Adenylsucc_synt 30 454 7e-252 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159184
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme adenylosuccinate synthetase which catalyzes the first committed step in the conversion of inosine monophosphate to adenosine monophosphate. A pseudogene of this gene is found on chromosome 17.[provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
Acbd6 A G 1: 155,624,897 D201G probably damaging Het
Adam17 G A 12: 21,325,587 R744C probably damaging Het
Ano3 T A 2: 110,885,000 K31I probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Cmya5 T G 13: 93,093,656 R1641S probably benign Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Frem1 T C 4: 82,913,607 R1991G probably benign Het
Gimap7 G A 6: 48,723,845 E122K probably benign Het
Hps3 A G 3: 20,003,223 probably null Het
Kctd2 A T 11: 115,427,519 K209N probably damaging Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Muc5ac T C 7: 141,791,224 V144A possibly damaging Het
Mypn T C 10: 63,192,510 Y258C probably damaging Het
Ntf3 T C 6: 126,102,442 M21V probably benign Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Olfr1447 A T 19: 12,901,133 C216S probably benign Het
Olfr802 G A 10: 129,682,218 H174Y possibly damaging Het
Olfr802 A T 10: 129,682,219 D173E probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Robo3 G A 9: 37,422,181 Q723* probably null Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Slc12a6 T A 2: 112,267,030 L70Q possibly damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Smim17 G T 7: 6,429,280 G74C probably damaging Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Suv39h2 G A 2: 3,464,808 T170I probably benign Het
Thrb A G 14: 18,033,551 K424R probably damaging Het
Tm4sf4 C T 3: 57,437,745 Q191* probably null Het
Trak1 G T 9: 121,442,797 probably null Het
Ttn A G 2: 76,710,274 S25796P probably damaging Het
Ugp2 T C 11: 21,353,366 R80G probably benign Het
Utp15 C T 13: 98,259,166 V103I probably benign Het
Wdr3 A T 3: 100,153,906 S249T probably benign Het
Zeb1 T A 18: 5,748,743 D86E probably damaging Het
Other mutations in Adss
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01094:Adss APN 1 177784942 missense probably damaging 0.99
IGL01770:Adss APN 1 177776509 missense possibly damaging 0.58
IGL02511:Adss APN 1 177771134 splice site probably benign
R0087:Adss UTSW 1 177771222 missense probably benign 0.05
R0607:Adss UTSW 1 177767687 missense possibly damaging 0.72
R1496:Adss UTSW 1 177772194 missense probably benign 0.13
R1888:Adss UTSW 1 177784951 nonsense probably null
R1888:Adss UTSW 1 177784951 nonsense probably null
R1958:Adss UTSW 1 177769978 missense probably damaging 1.00
R2867:Adss UTSW 1 177767812 splice site probably null
R2867:Adss UTSW 1 177767812 splice site probably null
R3886:Adss UTSW 1 177767769 missense probably damaging 1.00
R4288:Adss UTSW 1 177776512 missense probably damaging 1.00
R5373:Adss UTSW 1 177796388 missense probably benign
R5374:Adss UTSW 1 177796388 missense probably benign
R5729:Adss UTSW 1 177796258 missense possibly damaging 0.92
R6244:Adss UTSW 1 177776829 missense probably benign 0.00
R6314:Adss UTSW 1 177767768 missense probably damaging 1.00
R6777:Adss UTSW 1 177776336 splice site probably null
R7314:Adss UTSW 1 177767751 missense probably damaging 1.00
R7577:Adss UTSW 1 177767697 nonsense probably null
R7748:Adss UTSW 1 177772202 nonsense probably null
R7764:Adss UTSW 1 177764261 missense probably damaging 0.98
R8171:Adss UTSW 1 177796351 missense probably benign 0.00
R8885:Adss UTSW 1 177769960 missense probably damaging 1.00
Z1176:Adss UTSW 1 177776493 missense probably damaging 1.00
Z1176:Adss UTSW 1 177796498 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GACAAGAGTCAACATCCCAGGG -3'
(R):5'- TTATGACACAAGTCTGGTTTTGAGG -3'

Sequencing Primer
(F):5'- GAGTCAACATCCCAGGGAAATC -3'
(R):5'- ATCCCAGGATTTGCATAGGC -3'
Posted On2015-04-30