Incidental Mutation 'R3888:Rbm45'
ID312850
Institutional Source Beutler Lab
Gene Symbol Rbm45
Ensembl Gene ENSMUSG00000042369
Gene NameRNA binding motif protein 45
SynonymsG430095G15Rik, Drbp1, Drb1
MMRRC Submission 040800-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock #R3888 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location76369984-76383768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76375424 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 207 (S207G)
Ref Sequence ENSEMBL: ENSMUSP00000040420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046389]
Predicted Effect probably benign
Transcript: ENSMUST00000046389
AA Change: S207G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040420
Gene: ENSMUSG00000042369
AA Change: S207G

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
RRM 27 102 2.08e-12 SMART
RRM 122 191 1.37e-12 SMART
RRM 249 320 2.27e-1 SMART
RRM 394 460 4.07e-6 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RNA recognition motif (RRM)-type RNA-binding family of proteins. This protein exhibits preferential binding to poly(C) RNA. Initial cloning of this gene found that the rat ortholog was dynamically expressed in the developing rat brain. This protein has been localized to inclusion bodies in the brain and spinal cord of amyotrophic lateral sclerosis and Alzheimer's patients. A pseudogene has been identified on chromosome 8. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
Acbd6 A G 1: 155,624,897 D201G probably damaging Het
Adam17 G A 12: 21,325,587 R744C probably damaging Het
Adss A G 1: 177,767,769 Y402H probably damaging Het
Ano3 T A 2: 110,885,000 K31I probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Cmya5 T G 13: 93,093,656 R1641S probably benign Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Frem1 T C 4: 82,913,607 R1991G probably benign Het
Gimap7 G A 6: 48,723,845 E122K probably benign Het
Hps3 A G 3: 20,003,223 probably null Het
Kctd2 A T 11: 115,427,519 K209N probably damaging Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Muc5ac T C 7: 141,791,224 V144A possibly damaging Het
Mypn T C 10: 63,192,510 Y258C probably damaging Het
Ntf3 T C 6: 126,102,442 M21V probably benign Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Olfr1447 A T 19: 12,901,133 C216S probably benign Het
Olfr802 G A 10: 129,682,218 H174Y possibly damaging Het
Olfr802 A T 10: 129,682,219 D173E probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Robo3 G A 9: 37,422,181 Q723* probably null Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Slc12a6 T A 2: 112,267,030 L70Q possibly damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Smim17 G T 7: 6,429,280 G74C probably damaging Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Suv39h2 G A 2: 3,464,808 T170I probably benign Het
Thrb A G 14: 18,033,551 K424R probably damaging Het
Tm4sf4 C T 3: 57,437,745 Q191* probably null Het
Trak1 G T 9: 121,442,797 probably null Het
Ttn A G 2: 76,710,274 S25796P probably damaging Het
Ugp2 T C 11: 21,353,366 R80G probably benign Het
Utp15 C T 13: 98,259,166 V103I probably benign Het
Wdr3 A T 3: 100,153,906 S249T probably benign Het
Zeb1 T A 18: 5,748,743 D86E probably damaging Het
Other mutations in Rbm45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Rbm45 APN 2 76378707 missense probably damaging 1.00
IGL03335:Rbm45 APN 2 76376433 missense probably damaging 1.00
R0008:Rbm45 UTSW 2 76378398 missense probably damaging 1.00
R0008:Rbm45 UTSW 2 76378398 missense probably damaging 1.00
R0382:Rbm45 UTSW 2 76370211 missense possibly damaging 0.92
R1468:Rbm45 UTSW 2 76372115 missense probably damaging 1.00
R1468:Rbm45 UTSW 2 76372115 missense probably damaging 1.00
R1533:Rbm45 UTSW 2 76372159 critical splice donor site probably null
R1942:Rbm45 UTSW 2 76375479 critical splice donor site probably null
R2046:Rbm45 UTSW 2 76375398 missense probably benign
R2912:Rbm45 UTSW 2 76375454 missense probably benign 0.05
R2913:Rbm45 UTSW 2 76375454 missense probably benign 0.05
R2929:Rbm45 UTSW 2 76378419 missense probably benign 0.00
R3418:Rbm45 UTSW 2 76379018 missense probably damaging 1.00
R3886:Rbm45 UTSW 2 76375424 missense probably benign
R3887:Rbm45 UTSW 2 76375424 missense probably benign
R4488:Rbm45 UTSW 2 76376396 missense probably damaging 0.99
R5369:Rbm45 UTSW 2 76370250 missense probably damaging 1.00
R5990:Rbm45 UTSW 2 76370412 missense probably benign 0.36
R6569:Rbm45 UTSW 2 76379072 missense probably damaging 1.00
R6806:Rbm45 UTSW 2 76380460 missense probably benign 0.19
R7022:Rbm45 UTSW 2 76376394 missense probably damaging 1.00
R7832:Rbm45 UTSW 2 76376453 missense possibly damaging 0.80
R8720:Rbm45 UTSW 2 76380367 missense probably damaging 1.00
R8933:Rbm45 UTSW 2 76378724 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACCATGTAAATTCTGCCTTG -3'
(R):5'- GTTAGAAGAACTGAGCAACTTCTC -3'

Sequencing Primer
(F):5'- CACCATGTAAATTCTGCCTTGTATGG -3'
(R):5'- CCCAGCAACATATCAGATTTTCATTC -3'
Posted On2015-04-30