Incidental Mutation 'R3888:Slc12a6'
ID 312854
Institutional Source Beutler Lab
Gene Symbol Slc12a6
Ensembl Gene ENSMUSG00000027130
Gene Name solute carrier family 12, member 6
Synonyms KCC3, gaxp
MMRRC Submission 040800-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.212) question?
Stock # R3888 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 112096659-112193508 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 112097375 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 70 (L70Q)
Ref Sequence ENSEMBL: ENSMUSP00000124314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028549] [ENSMUST00000028553] [ENSMUST00000110987] [ENSMUST00000110991] [ENSMUST00000141047]
AlphaFold Q924N4
Predicted Effect probably benign
Transcript: ENSMUST00000028549
AA Change: L70Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000028549
Gene: ENSMUSG00000027130
AA Change: L70Q

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 114 171 8e-3 SMART
Pfam:AA_permease 190 384 4.1e-25 PFAM
Pfam:AA_permease 453 761 2.3e-43 PFAM
Pfam:SLC12 773 897 7.1e-20 PFAM
Pfam:SLC12 892 1150 3.9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000028553
SMART Domains Protein: ENSMUSP00000028553
Gene: ENSMUSG00000027133

DomainStartEndE-ValueType
Pfam:Nop10p 3 53 3.1e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110987
AA Change: L70Q

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106615
Gene: ENSMUSG00000027130
AA Change: L70Q

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 99 156 4e-3 SMART
Pfam:AA_permease 175 369 3.9e-25 PFAM
Pfam:AA_permease_2 421 704 3.2e-19 PFAM
Pfam:AA_permease 426 746 5.8e-41 PFAM
low complexity region 864 878 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110991
AA Change: L70Q

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106619
Gene: ENSMUSG00000027130
AA Change: L70Q

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 114 171 7e-3 SMART
Pfam:AA_permease 190 384 4.2e-25 PFAM
Pfam:AA_permease_2 436 719 2.9e-19 PFAM
Pfam:AA_permease 442 761 8.2e-41 PFAM
low complexity region 879 893 N/A INTRINSIC
Pfam:KCl_Cotrans_1 1018 1047 2.7e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000141047
AA Change: L70Q

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124314
Gene: ENSMUSG00000096764
AA Change: L70Q

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 99 156 8e-3 SMART
Pfam:AA_permease 175 369 6.6e-25 PFAM
Pfam:AA_permease 438 746 3.6e-43 PFAM
Pfam:SLC12 758 884 6.8e-20 PFAM
Pfam:SLC12 877 1033 5.9e-20 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the K-Cl cotransporter (KCC) family. K-Cl cotransporters are integral membrane proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The proteins encoded by this gene are activated by cell swelling induced by hypotonic conditions. Alternate splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are associated with agenesis of the corpus callosum with peripheral neuropathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit locomotor deficits, progressive neurodegeneration, slow progressive deafness and failure to breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,868,273 (GRCm39) probably null Het
Acbd6 A G 1: 155,500,643 (GRCm39) D201G probably damaging Het
Adam17 G A 12: 21,375,588 (GRCm39) R744C probably damaging Het
Adss2 A G 1: 177,595,335 (GRCm39) Y402H probably damaging Het
Ano3 T A 2: 110,715,345 (GRCm39) K31I probably damaging Het
B930094E09Rik G A 18: 31,742,742 (GRCm39) S59N unknown Het
Cmya5 T G 13: 93,230,164 (GRCm39) R1641S probably benign Het
Cps1 C A 1: 67,204,659 (GRCm39) T493K possibly damaging Het
Dmxl1 T A 18: 50,011,326 (GRCm39) M1161K probably damaging Het
Etl4 C T 2: 20,534,772 (GRCm39) Q76* probably null Het
Fn1 T C 1: 71,679,465 (GRCm39) Y511C probably damaging Het
Foxd2 T C 4: 114,765,483 (GRCm39) H179R unknown Het
Frem1 T C 4: 82,831,844 (GRCm39) R1991G probably benign Het
Gimap7 G A 6: 48,700,779 (GRCm39) E122K probably benign Het
Hps3 A G 3: 20,057,387 (GRCm39) probably null Het
Kctd2 A T 11: 115,318,345 (GRCm39) K209N probably damaging Het
Lcor T A 19: 41,546,795 (GRCm39) S126R probably damaging Het
Lct T C 1: 128,231,963 (GRCm39) M629V probably damaging Het
Lrp5 G A 19: 3,662,330 (GRCm39) R173C probably damaging Het
Muc5ac T C 7: 141,344,961 (GRCm39) V144A possibly damaging Het
Mypn T C 10: 63,028,289 (GRCm39) Y258C probably damaging Het
Ntf3 T C 6: 126,079,405 (GRCm39) M21V probably benign Het
Or4a71 T A 2: 89,358,076 (GRCm39) H226L possibly damaging Het
Or5b97 A T 19: 12,878,497 (GRCm39) C216S probably benign Het
Or6c1 A T 10: 129,518,088 (GRCm39) D173E probably benign Het
Or6c1 G A 10: 129,518,087 (GRCm39) H174Y possibly damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rbm45 A G 2: 76,205,768 (GRCm39) S207G probably benign Het
Robo3 G A 9: 37,333,477 (GRCm39) Q723* probably null Het
Rreb1 G T 13: 38,077,941 (GRCm39) R51L probably damaging Het
Slc15a2 A G 16: 36,602,666 (GRCm39) F65S probably damaging Het
Slitrk5 T A 14: 111,917,229 (GRCm39) C284* probably null Het
Smim17 G T 7: 6,432,279 (GRCm39) G74C probably damaging Het
Snapc4 G A 2: 26,255,510 (GRCm39) Q1005* probably null Het
Suv39h2 G A 2: 3,465,845 (GRCm39) T170I probably benign Het
Thrb A G 14: 18,033,551 (GRCm38) K424R probably damaging Het
Tm4sf4 C T 3: 57,345,166 (GRCm39) Q191* probably null Het
Trak1 G T 9: 121,271,863 (GRCm39) probably null Het
Ttn A G 2: 76,540,618 (GRCm39) S25796P probably damaging Het
Ugp2 T C 11: 21,303,366 (GRCm39) R80G probably benign Het
Utp15 C T 13: 98,395,674 (GRCm39) V103I probably benign Het
Wdr3 A T 3: 100,061,222 (GRCm39) S249T probably benign Het
Zeb1 T A 18: 5,748,743 (GRCm39) D86E probably damaging Het
Other mutations in Slc12a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01488:Slc12a6 APN 2 112,183,409 (GRCm39) splice site probably null
IGL02573:Slc12a6 APN 2 112,188,986 (GRCm39) critical splice donor site probably null
burgess UTSW 2 112,177,662 (GRCm39) missense probably benign 0.09
petrified_forest UTSW 2 112,177,771 (GRCm39) missense probably damaging 1.00
Prebiotic UTSW 2 112,183,280 (GRCm39) missense probably benign 0.30
R0548:Slc12a6 UTSW 2 112,166,269 (GRCm39) critical splice donor site probably null
R1495:Slc12a6 UTSW 2 112,184,535 (GRCm39) missense probably damaging 0.99
R1726:Slc12a6 UTSW 2 112,177,771 (GRCm39) missense probably damaging 1.00
R1856:Slc12a6 UTSW 2 112,166,272 (GRCm39) splice site probably null
R1958:Slc12a6 UTSW 2 112,185,503 (GRCm39) missense possibly damaging 0.92
R2112:Slc12a6 UTSW 2 112,186,830 (GRCm39) missense probably damaging 1.00
R2865:Slc12a6 UTSW 2 112,177,662 (GRCm39) missense probably benign 0.09
R4412:Slc12a6 UTSW 2 112,166,233 (GRCm39) missense possibly damaging 0.95
R4655:Slc12a6 UTSW 2 112,188,111 (GRCm39) critical splice acceptor site probably null
R4669:Slc12a6 UTSW 2 112,184,640 (GRCm39) missense probably damaging 1.00
R4928:Slc12a6 UTSW 2 112,183,306 (GRCm39) missense probably damaging 1.00
R4974:Slc12a6 UTSW 2 112,188,870 (GRCm39) missense probably damaging 1.00
R5016:Slc12a6 UTSW 2 112,186,972 (GRCm39) intron probably benign
R5372:Slc12a6 UTSW 2 112,177,705 (GRCm39) nonsense probably null
R5405:Slc12a6 UTSW 2 112,169,724 (GRCm39) missense probably damaging 1.00
R5786:Slc12a6 UTSW 2 112,115,067 (GRCm39) missense probably benign 0.01
R5836:Slc12a6 UTSW 2 112,172,343 (GRCm39) missense possibly damaging 0.62
R6280:Slc12a6 UTSW 2 112,167,703 (GRCm39) missense probably damaging 1.00
R6310:Slc12a6 UTSW 2 112,166,184 (GRCm39) missense probably damaging 1.00
R6525:Slc12a6 UTSW 2 112,182,796 (GRCm39) missense probably damaging 1.00
R6597:Slc12a6 UTSW 2 112,183,280 (GRCm39) missense probably damaging 1.00
R6723:Slc12a6 UTSW 2 112,168,287 (GRCm39) missense probably damaging 1.00
R6895:Slc12a6 UTSW 2 112,185,440 (GRCm39) missense probably damaging 1.00
R7059:Slc12a6 UTSW 2 112,183,257 (GRCm39) missense probably damaging 0.99
R7188:Slc12a6 UTSW 2 112,164,760 (GRCm39) missense probably benign 0.04
R7395:Slc12a6 UTSW 2 112,182,887 (GRCm39) missense probably damaging 1.00
R7552:Slc12a6 UTSW 2 112,172,319 (GRCm39) missense probably damaging 1.00
R7992:Slc12a6 UTSW 2 112,166,256 (GRCm39) missense probably damaging 1.00
R8016:Slc12a6 UTSW 2 112,186,899 (GRCm39) missense probably benign 0.42
R8122:Slc12a6 UTSW 2 112,097,167 (GRCm39) start codon destroyed probably null
R8192:Slc12a6 UTSW 2 112,181,722 (GRCm39) missense probably damaging 1.00
R8222:Slc12a6 UTSW 2 112,169,870 (GRCm39) splice site probably null
R8534:Slc12a6 UTSW 2 112,174,312 (GRCm39) missense probably damaging 1.00
R9018:Slc12a6 UTSW 2 112,174,585 (GRCm39) splice site probably benign
R9281:Slc12a6 UTSW 2 112,164,754 (GRCm39) missense probably benign 0.00
R9418:Slc12a6 UTSW 2 112,174,555 (GRCm39) missense
R9448:Slc12a6 UTSW 2 112,179,704 (GRCm39) missense probably damaging 1.00
R9460:Slc12a6 UTSW 2 112,183,280 (GRCm39) missense probably benign 0.30
R9694:Slc12a6 UTSW 2 112,174,881 (GRCm39) missense probably damaging 1.00
R9712:Slc12a6 UTSW 2 112,186,817 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACCAAGATGTCCTCAGTTC -3'
(R):5'- TGCAGTGACCTACTAACTGTCG -3'

Sequencing Primer
(F):5'- CAAGATGTCCTCAGTTCGGTTCATG -3'
(R):5'- GTCGCTATTATTCCCACACTCGTAAG -3'
Posted On 2015-04-30