Mutagenetix > Incidental Mutations

Incidental Mutation 'R3888:Slc12a6'

312854

Institutional Source

Beutler Lab

Gene Symbol

Slc12a6

Ensembl Gene

ENSMUSG00000027130

Gene Name

solute carrier family 12, member 6

Synonyms

gaxp, KCC3

MMRRC Submission

040800-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.276) question?

Stock #

R3888 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

112265825-112363163 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 112267030 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 70 (L70Q)

Ref Sequence

ENSEMBL: ENSMUSP00000124314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028549] [ENSMUST00000028553] [ENSMUST00000110987] [ENSMUST00000110991] [ENSMUST00000141047]

Predicted Effect

probably benign
Transcript: ENSMUST00000028549
AA Change: L70Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000028549
Gene: ENSMUSG00000027130
AA Change: L70Q

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
SCOP:d1qqea_	114	171	8e-3	SMART
Pfam:AA_permease	190	384	4.1e-25	PFAM
Pfam:AA_permease	453	761	2.3e-43	PFAM
Pfam:SLC12	773	897	7.1e-20	PFAM
Pfam:SLC12	892	1150	3.9e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000028553

SMART Domains

Protein: ENSMUSP00000028553
Gene: ENSMUSG00000027133

Domain	Start	End	E-Value	Type
Pfam:Nop10p	3	53	3.1e-26	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110987
AA Change: L70Q

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000106615
Gene: ENSMUSG00000027130
AA Change: L70Q

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
SCOP:d1qqea_	99	156	4e-3	SMART
Pfam:AA_permease	175	369	3.9e-25	PFAM
Pfam:AA_permease_2	421	704	3.2e-19	PFAM
Pfam:AA_permease	426	746	5.8e-41	PFAM
low complexity region	864	878	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110991
AA Change: L70Q

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000106619
Gene: ENSMUSG00000027130
AA Change: L70Q

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
SCOP:d1qqea_	114	171	7e-3	SMART
Pfam:AA_permease	190	384	4.2e-25	PFAM
Pfam:AA_permease_2	436	719	2.9e-19	PFAM
Pfam:AA_permease	442	761	8.2e-41	PFAM
low complexity region	879	893	N/A	INTRINSIC
Pfam:KCl_Cotrans_1	1018	1047	2.7e-23	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000141047
AA Change: L70Q

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000124314
Gene: ENSMUSG00000096764
AA Change: L70Q

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
SCOP:d1qqea_	99	156	8e-3	SMART
Pfam:AA_permease	175	369	6.6e-25	PFAM
Pfam:AA_permease	438	746	3.6e-43	PFAM
Pfam:SLC12	758	884	6.8e-20	PFAM
Pfam:SLC12	877	1033	5.9e-20	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the K-Cl cotransporter (KCC) family. K-Cl cotransporters are integral membrane proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The proteins encoded by this gene are activated by cell swelling induced by hypotonic conditions. Alternate splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are associated with agenesis of the corpus callosum with peripheral neuropathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit locomotor deficits, progressive neurodegeneration, slow progressive deafness and failure to breed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933407L21Rik	T	A	1: 85,940,551		probably null	Het
Acbd6	A	G	1: 155,624,897	D201G	probably damaging	Het
Adam17	G	A	12: 21,325,587	R744C	probably damaging	Het
Adss	A	G	1: 177,767,769	Y402H	probably damaging	Het
Ano3	T	A	2: 110,885,000	K31I	probably damaging	Het
B930094E09Rik	G	A	18: 31,609,689	S59N	unknown	Het
Cmya5	T	G	13: 93,093,656	R1641S	probably benign	Het
Cps1	C	A	1: 67,165,500	T493K	possibly damaging	Het
Dmxl1	T	A	18: 49,878,259	M1161K	probably damaging	Het
Etl4	C	T	2: 20,529,961	Q76*	probably null	Het
Fn1	T	C	1: 71,640,306	Y511C	probably damaging	Het
Foxd2	T	C	4: 114,908,286	H179R	unknown	Het
Frem1	T	C	4: 82,913,607	R1991G	probably benign	Het
Gimap7	G	A	6: 48,723,845	E122K	probably benign	Het
Hps3	A	G	3: 20,003,223		probably null	Het
Kctd2	A	T	11: 115,427,519	K209N	probably damaging	Het
Lcor	T	A	19: 41,558,356	S126R	probably damaging	Het
Lct	T	C	1: 128,304,226	M629V	probably damaging	Het
Lrp5	G	A	19: 3,612,330	R173C	probably damaging	Het
Muc5ac	T	C	7: 141,791,224	V144A	possibly damaging	Het
Mypn	T	C	10: 63,192,510	Y258C	probably damaging	Het
Ntf3	T	C	6: 126,102,442	M21V	probably benign	Het
Olfr1243	T	A	2: 89,527,732	H226L	possibly damaging	Het
Olfr1447	A	T	19: 12,901,133	C216S	probably benign	Het
Olfr802	G	A	10: 129,682,218	H174Y	possibly damaging	Het
Olfr802	A	T	10: 129,682,219	D173E	probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbm45	A	G	2: 76,375,424	S207G	probably benign	Het
Robo3	G	A	9: 37,422,181	Q723*	probably null	Het
Rreb1	G	T	13: 37,893,965	R51L	probably damaging	Het
Slc15a2	A	G	16: 36,782,304	F65S	probably damaging	Het
Slitrk5	T	A	14: 111,679,797	C284*	probably null	Het
Smim17	G	T	7: 6,429,280	G74C	probably damaging	Het
Snapc4	G	A	2: 26,365,498	Q1005*	probably null	Het
Suv39h2	G	A	2: 3,464,808	T170I	probably benign	Het
Thrb	A	G	14: 18,033,551	K424R	probably damaging	Het
Tm4sf4	C	T	3: 57,437,745	Q191*	probably null	Het
Trak1	G	T	9: 121,442,797		probably null	Het
Ttn	A	G	2: 76,710,274	S25796P	probably damaging	Het
Ugp2	T	C	11: 21,353,366	R80G	probably benign	Het
Utp15	C	T	13: 98,259,166	V103I	probably benign	Het
Wdr3	A	T	3: 100,153,906	S249T	probably benign	Het
Zeb1	T	A	18: 5,748,743	D86E	probably damaging	Het

Other mutations in Slc12a6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01488:Slc12a6	APN	2	112353064	splice site	probably null
IGL02573:Slc12a6	APN	2	112358641	critical splice donor site	probably null
R0548:Slc12a6	UTSW	2	112335924	critical splice donor site	probably null
R1495:Slc12a6	UTSW	2	112354190	missense	probably damaging	0.99
R1726:Slc12a6	UTSW	2	112347426	missense	probably damaging	1.00
R1856:Slc12a6	UTSW	2	112335927	splice site	probably null
R1958:Slc12a6	UTSW	2	112355158	missense	possibly damaging	0.92
R2112:Slc12a6	UTSW	2	112356485	missense	probably damaging	1.00
R2865:Slc12a6	UTSW	2	112347317	missense	probably benign	0.09
R4412:Slc12a6	UTSW	2	112335888	missense	possibly damaging	0.95
R4655:Slc12a6	UTSW	2	112357766	critical splice acceptor site	probably null
R4669:Slc12a6	UTSW	2	112354295	missense	probably damaging	1.00
R4928:Slc12a6	UTSW	2	112352961	missense	probably damaging	1.00
R4974:Slc12a6	UTSW	2	112358525	missense	probably damaging	1.00
R5016:Slc12a6	UTSW	2	112356627	intron	probably benign
R5372:Slc12a6	UTSW	2	112347360	nonsense	probably null
R5405:Slc12a6	UTSW	2	112339379	missense	probably damaging	1.00
R5786:Slc12a6	UTSW	2	112284722	missense	probably benign	0.01
R5836:Slc12a6	UTSW	2	112341998	missense	possibly damaging	0.62
R6280:Slc12a6	UTSW	2	112337358	missense	probably damaging	1.00
R6310:Slc12a6	UTSW	2	112335839	missense	probably damaging	1.00
R6525:Slc12a6	UTSW	2	112352451	missense	probably damaging	1.00
R6597:Slc12a6	UTSW	2	112352935	missense	probably damaging	1.00
R6723:Slc12a6	UTSW	2	112337942	missense	probably damaging	1.00
R6895:Slc12a6	UTSW	2	112355095	missense	probably damaging	1.00
R7059:Slc12a6	UTSW	2	112352912	missense	probably damaging	0.99
R7188:Slc12a6	UTSW	2	112334415	missense	probably benign	0.04
R7395:Slc12a6	UTSW	2	112352542	missense	probably damaging	1.00
R7552:Slc12a6	UTSW	2	112341974	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCACCAAGATGTCCTCAGTTC -3'
(R):5'- TGCAGTGACCTACTAACTGTCG -3'

Sequencing Primer
(F):5'- CAAGATGTCCTCAGTTCGGTTCATG -3'
(R):5'- GTCGCTATTATTCCCACACTCGTAAG -3'

Posted On

2015-04-30