Incidental Mutation 'R3888:Foxd2'
ID312860
Institutional Source Beutler Lab
Gene Symbol Foxd2
Ensembl Gene ENSMUSG00000055210
Gene Nameforkhead box D2
SynonymsMf2
MMRRC Submission 040800-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.451) question?
Stock #R3888 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location114906282-114908873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114908286 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 179 (H179R)
Ref Sequence ENSEMBL: ENSMUSP00000066868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068654]
Predicted Effect unknown
Transcript: ENSMUST00000068654
AA Change: H179R
SMART Domains Protein: ENSMUSP00000066868
Gene: ENSMUSG00000055210
AA Change: H179R

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
low complexity region 31 37 N/A INTRINSIC
low complexity region 57 73 N/A INTRINSIC
low complexity region 82 126 N/A INTRINSIC
FH 127 217 1.01e-60 SMART
low complexity region 229 259 N/A INTRINSIC
low complexity region 263 304 N/A INTRINSIC
low complexity region 310 351 N/A INTRINSIC
low complexity region 365 384 N/A INTRINSIC
low complexity region 392 404 N/A INTRINSIC
low complexity region 416 444 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144002
Meta Mutation Damage Score 0.9067 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors which is characterized by a distinct forkhead domain. The specific function of this gene has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit renal abnormalities including kidney hypoplasia and hydroureter. Penetrance is reduced, and dependent upon the genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
Acbd6 A G 1: 155,624,897 D201G probably damaging Het
Adam17 G A 12: 21,325,587 R744C probably damaging Het
Adss A G 1: 177,767,769 Y402H probably damaging Het
Ano3 T A 2: 110,885,000 K31I probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Cmya5 T G 13: 93,093,656 R1641S probably benign Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Frem1 T C 4: 82,913,607 R1991G probably benign Het
Gimap7 G A 6: 48,723,845 E122K probably benign Het
Hps3 A G 3: 20,003,223 probably null Het
Kctd2 A T 11: 115,427,519 K209N probably damaging Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Muc5ac T C 7: 141,791,224 V144A possibly damaging Het
Mypn T C 10: 63,192,510 Y258C probably damaging Het
Ntf3 T C 6: 126,102,442 M21V probably benign Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Olfr1447 A T 19: 12,901,133 C216S probably benign Het
Olfr802 G A 10: 129,682,218 H174Y possibly damaging Het
Olfr802 A T 10: 129,682,219 D173E probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Robo3 G A 9: 37,422,181 Q723* probably null Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Slc12a6 T A 2: 112,267,030 L70Q possibly damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Smim17 G T 7: 6,429,280 G74C probably damaging Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Suv39h2 G A 2: 3,464,808 T170I probably benign Het
Thrb A G 14: 18,033,551 K424R probably damaging Het
Tm4sf4 C T 3: 57,437,745 Q191* probably null Het
Trak1 G T 9: 121,442,797 probably null Het
Ttn A G 2: 76,710,274 S25796P probably damaging Het
Ugp2 T C 11: 21,353,366 R80G probably benign Het
Utp15 C T 13: 98,259,166 V103I probably benign Het
Wdr3 A T 3: 100,153,906 S249T probably benign Het
Zeb1 T A 18: 5,748,743 D86E probably damaging Het
Other mutations in Foxd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1168:Foxd2 UTSW 4 114907678 missense possibly damaging 0.85
R1183:Foxd2 UTSW 4 114907465 missense possibly damaging 0.68
R1479:Foxd2 UTSW 4 114907918 missense unknown
R3885:Foxd2 UTSW 4 114908286 missense unknown
R3886:Foxd2 UTSW 4 114908286 missense unknown
R3887:Foxd2 UTSW 4 114908286 missense unknown
R3889:Foxd2 UTSW 4 114908286 missense unknown
R4874:Foxd2 UTSW 4 114907571 missense possibly damaging 0.53
R5646:Foxd2 UTSW 4 114908635 missense unknown
R6126:Foxd2 UTSW 4 114908505 missense unknown
R7235:Foxd2 UTSW 4 114908271 missense unknown
R7749:Foxd2 UTSW 4 114907812 missense unknown
Z1177:Foxd2 UTSW 4 114907887 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAAAGCCTTGGCGCAACC -3'
(R):5'- ACGGAGCCCTCTGGTGAAA -3'

Sequencing Primer
(F):5'- ACTGACAGCTGGCAAGGC -3'
(R):5'- GTGAAACCACCTTATTCGTACATCG -3'
Posted On2015-04-30