Incidental Mutation 'R3888:Gimap7'
ID 312861
Institutional Source Beutler Lab
Gene Symbol Gimap7
Ensembl Gene ENSMUSG00000043931
Gene Name GTPase, IMAP family member 7
Synonyms Ian3, IAN7
MMRRC Submission 040800-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R3888 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 48695555-48701570 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 48700779 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 122 (E122K)
Ref Sequence ENSEMBL: ENSMUSP00000057143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052503] [ENSMUST00000127537] [ENSMUST00000204785]
AlphaFold Q8R379
Predicted Effect probably benign
Transcript: ENSMUST00000052503
AA Change: E122K

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000057143
Gene: ENSMUSG00000043931
AA Change: E122K

DomainStartEndE-ValueType
Pfam:AIG1 9 218 1.2e-82 PFAM
Pfam:MMR_HSR1 10 144 8.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204317
Predicted Effect probably benign
Transcript: ENSMUST00000204785
SMART Domains Protein: ENSMUSP00000145238
Gene: ENSMUSG00000043931

DomainStartEndE-ValueType
Pfam:FeoB_N 9 82 7.2e-5 PFAM
Pfam:AIG1 9 86 3.9e-31 PFAM
Pfam:MMR_HSR1 10 86 7.5e-10 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. In humans, the IAN subfamily genes are located in a cluster at 7q36.1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,868,273 (GRCm39) probably null Het
Acbd6 A G 1: 155,500,643 (GRCm39) D201G probably damaging Het
Adam17 G A 12: 21,375,588 (GRCm39) R744C probably damaging Het
Adss2 A G 1: 177,595,335 (GRCm39) Y402H probably damaging Het
Ano3 T A 2: 110,715,345 (GRCm39) K31I probably damaging Het
B930094E09Rik G A 18: 31,742,742 (GRCm39) S59N unknown Het
Cmya5 T G 13: 93,230,164 (GRCm39) R1641S probably benign Het
Cps1 C A 1: 67,204,659 (GRCm39) T493K possibly damaging Het
Dmxl1 T A 18: 50,011,326 (GRCm39) M1161K probably damaging Het
Etl4 C T 2: 20,534,772 (GRCm39) Q76* probably null Het
Fn1 T C 1: 71,679,465 (GRCm39) Y511C probably damaging Het
Foxd2 T C 4: 114,765,483 (GRCm39) H179R unknown Het
Frem1 T C 4: 82,831,844 (GRCm39) R1991G probably benign Het
Hps3 A G 3: 20,057,387 (GRCm39) probably null Het
Kctd2 A T 11: 115,318,345 (GRCm39) K209N probably damaging Het
Lcor T A 19: 41,546,795 (GRCm39) S126R probably damaging Het
Lct T C 1: 128,231,963 (GRCm39) M629V probably damaging Het
Lrp5 G A 19: 3,662,330 (GRCm39) R173C probably damaging Het
Muc5ac T C 7: 141,344,961 (GRCm39) V144A possibly damaging Het
Mypn T C 10: 63,028,289 (GRCm39) Y258C probably damaging Het
Ntf3 T C 6: 126,079,405 (GRCm39) M21V probably benign Het
Or4a71 T A 2: 89,358,076 (GRCm39) H226L possibly damaging Het
Or5b97 A T 19: 12,878,497 (GRCm39) C216S probably benign Het
Or6c1 G A 10: 129,518,087 (GRCm39) H174Y possibly damaging Het
Or6c1 A T 10: 129,518,088 (GRCm39) D173E probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rbm45 A G 2: 76,205,768 (GRCm39) S207G probably benign Het
Robo3 G A 9: 37,333,477 (GRCm39) Q723* probably null Het
Rreb1 G T 13: 38,077,941 (GRCm39) R51L probably damaging Het
Slc12a6 T A 2: 112,097,375 (GRCm39) L70Q possibly damaging Het
Slc15a2 A G 16: 36,602,666 (GRCm39) F65S probably damaging Het
Slitrk5 T A 14: 111,917,229 (GRCm39) C284* probably null Het
Smim17 G T 7: 6,432,279 (GRCm39) G74C probably damaging Het
Snapc4 G A 2: 26,255,510 (GRCm39) Q1005* probably null Het
Suv39h2 G A 2: 3,465,845 (GRCm39) T170I probably benign Het
Thrb A G 14: 18,033,551 (GRCm38) K424R probably damaging Het
Tm4sf4 C T 3: 57,345,166 (GRCm39) Q191* probably null Het
Trak1 G T 9: 121,271,863 (GRCm39) probably null Het
Ttn A G 2: 76,540,618 (GRCm39) S25796P probably damaging Het
Ugp2 T C 11: 21,303,366 (GRCm39) R80G probably benign Het
Utp15 C T 13: 98,395,674 (GRCm39) V103I probably benign Het
Wdr3 A T 3: 100,061,222 (GRCm39) S249T probably benign Het
Zeb1 T A 18: 5,748,743 (GRCm39) D86E probably damaging Het
Other mutations in Gimap7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Gimap7 APN 6 48,700,667 (GRCm39) nonsense probably null
IGL01508:Gimap7 APN 6 48,701,230 (GRCm39) missense probably damaging 0.98
IGL03134:Gimap7 UTSW 6 48,700,435 (GRCm39) missense probably benign 0.04
R0848:Gimap7 UTSW 6 48,700,657 (GRCm39) missense probably damaging 0.99
R1590:Gimap7 UTSW 6 48,700,953 (GRCm39) missense probably damaging 0.96
R1603:Gimap7 UTSW 6 48,700,864 (GRCm39) missense probably damaging 1.00
R1874:Gimap7 UTSW 6 48,700,449 (GRCm39) missense possibly damaging 0.81
R1982:Gimap7 UTSW 6 48,701,175 (GRCm39) missense possibly damaging 0.83
R2471:Gimap7 UTSW 6 48,700,986 (GRCm39) missense probably damaging 0.99
R5512:Gimap7 UTSW 6 48,700,530 (GRCm39) missense probably benign 0.07
R6378:Gimap7 UTSW 6 48,701,116 (GRCm39) missense probably damaging 1.00
R7699:Gimap7 UTSW 6 48,700,791 (GRCm39) missense possibly damaging 0.48
R7700:Gimap7 UTSW 6 48,700,791 (GRCm39) missense possibly damaging 0.48
R9172:Gimap7 UTSW 6 48,700,761 (GRCm39) nonsense probably null
R9320:Gimap7 UTSW 6 48,701,260 (GRCm39) missense probably benign 0.16
R9627:Gimap7 UTSW 6 48,700,600 (GRCm39) missense probably damaging 1.00
R9789:Gimap7 UTSW 6 48,700,470 (GRCm39) missense probably damaging 0.96
Z1176:Gimap7 UTSW 6 48,701,087 (GRCm39) missense probably benign 0.03
Z1177:Gimap7 UTSW 6 48,701,255 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCCTGGTTGTTGATACCCCAG -3'
(R):5'- TGCACCAGGGTTTCTACAAGC -3'

Sequencing Primer
(F):5'- GTTGTTGATACCCCAGGGCTC -3'
(R):5'- GGGTTTCTACAAGCCCCATCAG -3'
Posted On 2015-04-30