Incidental Mutation 'R3888:Gimap7'
ID312861
Institutional Source Beutler Lab
Gene Symbol Gimap7
Ensembl Gene ENSMUSG00000043931
Gene NameGTPase, IMAP family member 7
SynonymsIAN7, Ian3
MMRRC Submission 040800-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R3888 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location48718621-48724636 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 48723845 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 122 (E122K)
Ref Sequence ENSEMBL: ENSMUSP00000057143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052503] [ENSMUST00000127537] [ENSMUST00000204785]
Predicted Effect probably benign
Transcript: ENSMUST00000052503
AA Change: E122K

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000057143
Gene: ENSMUSG00000043931
AA Change: E122K

DomainStartEndE-ValueType
Pfam:AIG1 9 218 1.2e-82 PFAM
Pfam:MMR_HSR1 10 144 8.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204317
Predicted Effect probably benign
Transcript: ENSMUST00000204785
SMART Domains Protein: ENSMUSP00000145238
Gene: ENSMUSG00000043931

DomainStartEndE-ValueType
Pfam:FeoB_N 9 82 7.2e-5 PFAM
Pfam:AIG1 9 86 3.9e-31 PFAM
Pfam:MMR_HSR1 10 86 7.5e-10 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. In humans, the IAN subfamily genes are located in a cluster at 7q36.1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
Acbd6 A G 1: 155,624,897 D201G probably damaging Het
Adam17 G A 12: 21,325,587 R744C probably damaging Het
Adss A G 1: 177,767,769 Y402H probably damaging Het
Ano3 T A 2: 110,885,000 K31I probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Cmya5 T G 13: 93,093,656 R1641S probably benign Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Frem1 T C 4: 82,913,607 R1991G probably benign Het
Hps3 A G 3: 20,003,223 probably null Het
Kctd2 A T 11: 115,427,519 K209N probably damaging Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Muc5ac T C 7: 141,791,224 V144A possibly damaging Het
Mypn T C 10: 63,192,510 Y258C probably damaging Het
Ntf3 T C 6: 126,102,442 M21V probably benign Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Olfr1447 A T 19: 12,901,133 C216S probably benign Het
Olfr802 G A 10: 129,682,218 H174Y possibly damaging Het
Olfr802 A T 10: 129,682,219 D173E probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Robo3 G A 9: 37,422,181 Q723* probably null Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Slc12a6 T A 2: 112,267,030 L70Q possibly damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Smim17 G T 7: 6,429,280 G74C probably damaging Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Suv39h2 G A 2: 3,464,808 T170I probably benign Het
Thrb A G 14: 18,033,551 K424R probably damaging Het
Tm4sf4 C T 3: 57,437,745 Q191* probably null Het
Trak1 G T 9: 121,442,797 probably null Het
Ttn A G 2: 76,710,274 S25796P probably damaging Het
Ugp2 T C 11: 21,353,366 R80G probably benign Het
Utp15 C T 13: 98,259,166 V103I probably benign Het
Wdr3 A T 3: 100,153,906 S249T probably benign Het
Zeb1 T A 18: 5,748,743 D86E probably damaging Het
Other mutations in Gimap7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Gimap7 APN 6 48723733 nonsense probably null
IGL01508:Gimap7 APN 6 48724296 missense probably damaging 0.98
IGL03134:Gimap7 UTSW 6 48723501 missense probably benign 0.04
R0848:Gimap7 UTSW 6 48723723 missense probably damaging 0.99
R1590:Gimap7 UTSW 6 48724019 missense probably damaging 0.96
R1603:Gimap7 UTSW 6 48723930 missense probably damaging 1.00
R1874:Gimap7 UTSW 6 48723515 missense possibly damaging 0.81
R1982:Gimap7 UTSW 6 48724241 missense possibly damaging 0.83
R2471:Gimap7 UTSW 6 48724052 missense probably damaging 0.99
R5512:Gimap7 UTSW 6 48723596 missense probably benign 0.07
R6378:Gimap7 UTSW 6 48724182 missense probably damaging 1.00
R7699:Gimap7 UTSW 6 48723857 missense possibly damaging 0.48
R7700:Gimap7 UTSW 6 48723857 missense possibly damaging 0.48
Z1176:Gimap7 UTSW 6 48724153 missense probably benign 0.03
Z1177:Gimap7 UTSW 6 48724321 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCCTGGTTGTTGATACCCCAG -3'
(R):5'- TGCACCAGGGTTTCTACAAGC -3'

Sequencing Primer
(F):5'- GTTGTTGATACCCCAGGGCTC -3'
(R):5'- GGGTTTCTACAAGCCCCATCAG -3'
Posted On2015-04-30