Incidental Mutation 'R3888:Ntf3'
ID312863
Institutional Source Beutler Lab
Gene Symbol Ntf3
Ensembl Gene ENSMUSG00000049107
Gene Nameneurotrophin 3
SynonymsNT-3, Ntf-3, NT3
MMRRC Submission 040800-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3888 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location126101412-126166910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126102442 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 21 (M21V)
Ref Sequence ENSEMBL: ENSMUSP00000052302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050484] [ENSMUST00000112244] [ENSMUST00000204542]
Predicted Effect probably benign
Transcript: ENSMUST00000050484
AA Change: M21V

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000052302
Gene: ENSMUSG00000049107
AA Change: M21V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
NGF 145 250 1.19e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112244
AA Change: M34V

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107863
Gene: ENSMUSG00000049107
AA Change: M34V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
NGF 158 263 1.19e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204542
AA Change: M34V

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000144828
Gene: ENSMUSG00000049107
AA Change: M34V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
NGF 158 263 1.19e-85 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the neurotrophins that have a wide variety of functions in both neural and non-neural tissues. The encoded preproprotein undergoes proteolytic processing to generate a noncovalently linked homodimeric mature protein that can bind to the transmembrane receptor tyrosine kinases to initiate a series of signaling events. Mice lacking the encoded protein exhibit severe defects in the peripheral nervous system including a complete lack of spinal proprioceptive afferents and their peripheral sense organs. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit loss of peripheral sensory and sympathetic neurons, lack of spinal propioceptive afferents and their sense organs, impaired suckling and movement, and postnatal lethality. Heterozygotes show mild defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
Acbd6 A G 1: 155,624,897 D201G probably damaging Het
Adam17 G A 12: 21,325,587 R744C probably damaging Het
Adss A G 1: 177,767,769 Y402H probably damaging Het
Ano3 T A 2: 110,885,000 K31I probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Cmya5 T G 13: 93,093,656 R1641S probably benign Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Frem1 T C 4: 82,913,607 R1991G probably benign Het
Gimap7 G A 6: 48,723,845 E122K probably benign Het
Hps3 A G 3: 20,003,223 probably null Het
Kctd2 A T 11: 115,427,519 K209N probably damaging Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Muc5ac T C 7: 141,791,224 V144A possibly damaging Het
Mypn T C 10: 63,192,510 Y258C probably damaging Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Olfr1447 A T 19: 12,901,133 C216S probably benign Het
Olfr802 G A 10: 129,682,218 H174Y possibly damaging Het
Olfr802 A T 10: 129,682,219 D173E probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Robo3 G A 9: 37,422,181 Q723* probably null Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Slc12a6 T A 2: 112,267,030 L70Q possibly damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Smim17 G T 7: 6,429,280 G74C probably damaging Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Suv39h2 G A 2: 3,464,808 T170I probably benign Het
Thrb A G 14: 18,033,551 K424R probably damaging Het
Tm4sf4 C T 3: 57,437,745 Q191* probably null Het
Trak1 G T 9: 121,442,797 probably null Het
Ttn A G 2: 76,710,274 S25796P probably damaging Het
Ugp2 T C 11: 21,353,366 R80G probably benign Het
Utp15 C T 13: 98,259,166 V103I probably benign Het
Wdr3 A T 3: 100,153,906 S249T probably benign Het
Zeb1 T A 18: 5,748,743 D86E probably damaging Het
Other mutations in Ntf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02552:Ntf3 APN 6 126101860 missense probably damaging 0.99
IGL02982:Ntf3 APN 6 126102377 missense probably damaging 0.99
PIT4403001:Ntf3 UTSW 6 126101826 missense probably damaging 1.00
R0026:Ntf3 UTSW 6 126101805 missense probably damaging 1.00
R1219:Ntf3 UTSW 6 126102211 missense possibly damaging 0.93
R1666:Ntf3 UTSW 6 126102438 missense possibly damaging 0.70
R1822:Ntf3 UTSW 6 126102246 missense probably benign 0.10
R1920:Ntf3 UTSW 6 126102522 missense possibly damaging 0.46
R2255:Ntf3 UTSW 6 126101726 makesense probably null
R4196:Ntf3 UTSW 6 126102175 missense probably benign 0.41
R6707:Ntf3 UTSW 6 126164728 critical splice donor site probably null
R6983:Ntf3 UTSW 6 126101845 missense probably damaging 0.98
R7357:Ntf3 UTSW 6 126101998 missense probably damaging 1.00
R7663:Ntf3 UTSW 6 126101815 missense probably damaging 1.00
R7895:Ntf3 UTSW 6 126102240 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCGTTGCAATCATTGGCTGG -3'
(R):5'- TGTTAGACTGGTGGTACCCTCTC -3'

Sequencing Primer
(F):5'- GCAATCATTGGCTGGAACTC -3'
(R):5'- CCTCACTCTCAGATTGTCAGC -3'
Posted On2015-04-30