Mutagenetix > Incidental Mutations

Incidental Mutation 'R3888:Trak1'

312868

Institutional Source

Beutler Lab

Gene Symbol

Trak1

Ensembl Gene

ENSMUSG00000032536

Gene Name

trafficking protein, kinesin binding 1

Synonyms

hyrt, 2310001H13Rik

MMRRC Submission

040800-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.277) question?

Stock #

R3888 (G1)

Quality Score

215

Status

Not validated

Chromosome

Chromosomal Location

121297502-121474918 bp(+) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to T at 121442797 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148026 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045903] [ENSMUST00000209995] [ENSMUST00000210351] [ENSMUST00000210351] [ENSMUST00000210636] [ENSMUST00000210636] [ENSMUST00000210798] [ENSMUST00000210798] [ENSMUST00000211187] [ENSMUST00000211187] [ENSMUST00000211301] [ENSMUST00000211439] [ENSMUST00000211439]

Predicted Effect

probably null
Transcript: ENSMUST00000045903

SMART Domains

Protein: ENSMUSP00000044482
Gene: ENSMUSG00000032536

Domain	Start	End	E-Value	Type
Pfam:HAP1_N	47	352	8.1e-139	PFAM
Pfam:Milton	411	580	5e-72	PFAM
low complexity region	882	897	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209995

Predicted Effect

probably null
Transcript: ENSMUST00000210351

Predicted Effect

probably null
Transcript: ENSMUST00000210351

Predicted Effect

probably null
Transcript: ENSMUST00000210636

Predicted Effect

probably null
Transcript: ENSMUST00000210636

Predicted Effect

probably null
Transcript: ENSMUST00000210798

Predicted Effect

probably null
Transcript: ENSMUST00000210798

Predicted Effect

probably null
Transcript: ENSMUST00000211187

Predicted Effect

probably null
Transcript: ENSMUST00000211187

Predicted Effect

probably benign
Transcript: ENSMUST00000211301

Predicted Effect

probably null
Transcript: ENSMUST00000211439

Predicted Effect

probably null
Transcript: ENSMUST00000211439

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211699

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice with a spontaneous mutation in this allele have various behavioral abnormalities consistent with hypertonia. Inclusions can be found in neuronal processes of the gray matter of the brainstem and spinal cord. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933407L21Rik	T	A	1: 85,940,551		probably null	Het
Acbd6	A	G	1: 155,624,897	D201G	probably damaging	Het
Adam17	G	A	12: 21,325,587	R744C	probably damaging	Het
Adss	A	G	1: 177,767,769	Y402H	probably damaging	Het
Ano3	T	A	2: 110,885,000	K31I	probably damaging	Het
B930094E09Rik	G	A	18: 31,609,689	S59N	unknown	Het
Cmya5	T	G	13: 93,093,656	R1641S	probably benign	Het
Cps1	C	A	1: 67,165,500	T493K	possibly damaging	Het
Dmxl1	T	A	18: 49,878,259	M1161K	probably damaging	Het
Etl4	C	T	2: 20,529,961	Q76*	probably null	Het
Fn1	T	C	1: 71,640,306	Y511C	probably damaging	Het
Foxd2	T	C	4: 114,908,286	H179R	unknown	Het
Frem1	T	C	4: 82,913,607	R1991G	probably benign	Het
Gimap7	G	A	6: 48,723,845	E122K	probably benign	Het
Hps3	A	G	3: 20,003,223		probably null	Het
Kctd2	A	T	11: 115,427,519	K209N	probably damaging	Het
Lcor	T	A	19: 41,558,356	S126R	probably damaging	Het
Lct	T	C	1: 128,304,226	M629V	probably damaging	Het
Lrp5	G	A	19: 3,612,330	R173C	probably damaging	Het
Muc5ac	T	C	7: 141,791,224	V144A	possibly damaging	Het
Mypn	T	C	10: 63,192,510	Y258C	probably damaging	Het
Ntf3	T	C	6: 126,102,442	M21V	probably benign	Het
Olfr1243	T	A	2: 89,527,732	H226L	possibly damaging	Het
Olfr1447	A	T	19: 12,901,133	C216S	probably benign	Het
Olfr802	G	A	10: 129,682,218	H174Y	possibly damaging	Het
Olfr802	A	T	10: 129,682,219	D173E	probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbm45	A	G	2: 76,375,424	S207G	probably benign	Het
Robo3	G	A	9: 37,422,181	Q723*	probably null	Het
Rreb1	G	T	13: 37,893,965	R51L	probably damaging	Het
Slc12a6	T	A	2: 112,267,030	L70Q	possibly damaging	Het
Slc15a2	A	G	16: 36,782,304	F65S	probably damaging	Het
Slitrk5	T	A	14: 111,679,797	C284*	probably null	Het
Smim17	G	T	7: 6,429,280	G74C	probably damaging	Het
Snapc4	G	A	2: 26,365,498	Q1005*	probably null	Het
Suv39h2	G	A	2: 3,464,808	T170I	probably benign	Het
Thrb	A	G	14: 18,033,551	K424R	probably damaging	Het
Tm4sf4	C	T	3: 57,437,745	Q191*	probably null	Het
Ttn	A	G	2: 76,710,274	S25796P	probably damaging	Het
Ugp2	T	C	11: 21,353,366	R80G	probably benign	Het
Utp15	C	T	13: 98,259,166	V103I	probably benign	Het
Wdr3	A	T	3: 100,153,906	S249T	probably benign	Het
Zeb1	T	A	18: 5,748,743	D86E	probably damaging	Het

Other mutations in Trak1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Trak1	APN	9	121443736	critical splice donor site	probably null
IGL01335:Trak1	APN	9	121454316	missense	possibly damaging	0.58
IGL01777:Trak1	APN	9	121431560	splice site	probably null
IGL01804:Trak1	APN	9	121442685	splice site	probably benign
IGL01986:Trak1	APN	9	121472967	missense	probably benign	0.00
IGL02248:Trak1	APN	9	121446794	missense	probably damaging	1.00
IGL02276:Trak1	APN	9	121451668	missense	probably damaging	1.00
IGL02556:Trak1	APN	9	121448901	missense	probably damaging	1.00
IGL03368:Trak1	APN	9	121367122	missense	possibly damaging	0.66
PIT4468001:Trak1	UTSW	9	121453332	missense	probably benign	0.18
R0067:Trak1	UTSW	9	121472907	missense	probably damaging	1.00
R0276:Trak1	UTSW	9	121454338	missense	probably damaging	0.97
R0535:Trak1	UTSW	9	121443712	missense	probably null	1.00
R0629:Trak1	UTSW	9	121367167	missense	probably benign	0.37
R0671:Trak1	UTSW	9	121448955	critical splice donor site	probably null
R0883:Trak1	UTSW	9	121453285	missense	possibly damaging	0.90
R1160:Trak1	UTSW	9	121392007	missense	probably benign	0.01
R1162:Trak1	UTSW	9	121453341	missense	possibly damaging	0.93
R1168:Trak1	UTSW	9	121440679	missense	probably damaging	1.00
R1398:Trak1	UTSW	9	121454359	missense	probably damaging	1.00
R2118:Trak1	UTSW	9	121472997	makesense	probably null
R2119:Trak1	UTSW	9	121472997	makesense	probably null
R2120:Trak1	UTSW	9	121472997	makesense	probably null
R2137:Trak1	UTSW	9	121472962	missense	possibly damaging	0.83
R3162:Trak1	UTSW	9	121451734	splice site	probably benign
R3889:Trak1	UTSW	9	121445873	missense	probably null	0.40
R4031:Trak1	UTSW	9	121451670	missense	probably damaging	1.00
R4116:Trak1	UTSW	9	121448843	missense	probably damaging	1.00
R4406:Trak1	UTSW	9	121431536	missense	probably damaging	1.00
R4630:Trak1	UTSW	9	121454425	missense	probably benign	0.02
R4631:Trak1	UTSW	9	121454425	missense	probably benign	0.02
R4632:Trak1	UTSW	9	121454425	missense	probably benign	0.02
R4786:Trak1	UTSW	9	121472494	missense	probably benign	0.25
R5137:Trak1	UTSW	9	121367055	intron	probably benign
R5159:Trak1	UTSW	9	121460412	missense	probably damaging	0.99
R5467:Trak1	UTSW	9	121446798	missense	probably damaging	1.00
R5661:Trak1	UTSW	9	121443637	missense	possibly damaging	0.46
R5664:Trak1	UTSW	9	121472307	missense	possibly damaging	0.47
R5769:Trak1	UTSW	9	121448838	missense	probably damaging	1.00
R6041:Trak1	UTSW	9	121460412	missense	probably damaging	0.99
R6257:Trak1	UTSW	9	121446755	missense	probably damaging	1.00
R6257:Trak1	UTSW	9	121367224	missense	possibly damaging	0.92
R6354:Trak1	UTSW	9	121451726	missense	probably null	0.03
R6399:Trak1	UTSW	9	121453496	splice site	probably null
R6513:Trak1	UTSW	9	121443756	missense	probably benign
R6579:Trak1	UTSW	9	121443638	missense	probably benign	0.29
R6940:Trak1	UTSW	9	121443718	missense	possibly damaging	0.78
R7120:Trak1	UTSW	9	121460498	missense	probably benign
R7299:Trak1	UTSW	9	121451863	splice site	probably null
R7304:Trak1	UTSW	9	121416212	missense	probably benign
R7396:Trak1	UTSW	9	121448907	missense	possibly damaging	0.71
R7522:Trak1	UTSW	9	121442711	missense	probably damaging	0.99
R7657:Trak1	UTSW	9	121472586	missense	probably damaging	1.00
R7733:Trak1	UTSW	9	121367225	missense	possibly damaging	0.92
R7793:Trak1	UTSW	9	121416198	nonsense	probably null
R7999:Trak1	UTSW	9	121460425	missense	probably damaging	1.00
R8209:Trak1	UTSW	9	121451727	missense	probably benign
R8215:Trak1	UTSW	9	121469030	missense	probably damaging	1.00
R8226:Trak1	UTSW	9	121451727	missense	probably benign
R8261:Trak1	UTSW	9	121451667	missense	probably damaging	1.00
R8300:Trak1	UTSW	9	121460499	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCTTTGAGACTCTGAGTAGCAAAC -3'
(R):5'- TCCACTCAGCAGCTCACTTG -3'

Sequencing Primer
(F):5'- AACCAGCCTTCACTTGGGATG -3'
(R):5'- CAGCAGCTCACTTGAAGCAGTG -3'

Posted On

2015-04-30