Mutagenetix > Incidental Mutation

Incidental Mutation 'R3888:Mypn'

312869

Institutional Source

Beutler Lab

Gene Symbol

Mypn

Ensembl Gene

ENSMUSG00000020067

Gene Name

myopalladin

Synonyms

1110056A04Rik

MMRRC Submission

040800-MU

Accession Numbers

Genbank: NM_182992; MGI: 1916052

Is this an essential gene?

Possibly non essential (E-score: 0.313) question?

Stock #

R3888 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

63115795-63203952 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 63192510 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 258 (Y258C)

Ref Sequence

ENSEMBL: ENSMUSP00000093240 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095580]

AlphaFold

Q5DTJ9

Predicted Effect

probably damaging
Transcript: ENSMUST00000095580
AA Change: Y258C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000093240
Gene: ENSMUSG00000020067
AA Change: Y258C

Domain	Start	End	E-Value	Type
low complexity region	46	56	N/A	INTRINSIC
low complexity region	225	245	N/A	INTRINSIC
IGc2	279	346	2.16e-8	SMART
low complexity region	384	405	N/A	INTRINSIC
IGc2	444	519	1.69e-10	SMART
low complexity region	636	648	N/A	INTRINSIC
low complexity region	659	675	N/A	INTRINSIC
low complexity region	721	741	N/A	INTRINSIC
low complexity region	779	794	N/A	INTRINSIC
low complexity region	826	838	N/A	INTRINSIC
low complexity region	922	933	N/A	INTRINSIC
IGc2	953	1022	1.64e-8	SMART
IGc2	1080	1148	3.67e-11	SMART
IG	1173	1259	1.17e-4	SMART

Meta Mutation Damage Score

0.0842

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Striated muscle in vertebrates comprises large proteins which must be organized properly to contract efficiently. Z-lines in striated muscle are a sign of this organization, representing the ends of actin thin filaments, titin, nebulin or nebulette and accessory proteins required for structure and function. This gene encodes a protein which interacts with nebulin in skeletal muscle or nebulette in cardiac muscle and alpha-actinin. In addition, this gene product can interact with a protein with the I-band indicating it has a regulatory as well as structural function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]

Allele List at MGI

All alleles(51) : Gene trapped(51)

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933407L21Rik	T	A	1: 85,940,551		probably null	Het
Acbd6	A	G	1: 155,624,897	D201G	probably damaging	Het
Adam17	G	A	12: 21,325,587	R744C	probably damaging	Het
Adss	A	G	1: 177,767,769	Y402H	probably damaging	Het
Ano3	T	A	2: 110,885,000	K31I	probably damaging	Het
B930094E09Rik	G	A	18: 31,609,689	S59N	unknown	Het
Cmya5	T	G	13: 93,093,656	R1641S	probably benign	Het
Cps1	C	A	1: 67,165,500	T493K	possibly damaging	Het
Dmxl1	T	A	18: 49,878,259	M1161K	probably damaging	Het
Etl4	C	T	2: 20,529,961	Q76*	probably null	Het
Fn1	T	C	1: 71,640,306	Y511C	probably damaging	Het
Foxd2	T	C	4: 114,908,286	H179R	unknown	Het
Frem1	T	C	4: 82,913,607	R1991G	probably benign	Het
Gimap7	G	A	6: 48,723,845	E122K	probably benign	Het
Hps3	A	G	3: 20,003,223		probably null	Het
Kctd2	A	T	11: 115,427,519	K209N	probably damaging	Het
Lcor	T	A	19: 41,558,356	S126R	probably damaging	Het
Lct	T	C	1: 128,304,226	M629V	probably damaging	Het
Lrp5	G	A	19: 3,612,330	R173C	probably damaging	Het
Muc5ac	T	C	7: 141,791,224	V144A	possibly damaging	Het
Ntf3	T	C	6: 126,102,442	M21V	probably benign	Het
Olfr1243	T	A	2: 89,527,732	H226L	possibly damaging	Het
Olfr1447	A	T	19: 12,901,133	C216S	probably benign	Het
Olfr802	G	A	10: 129,682,218	H174Y	possibly damaging	Het
Olfr802	A	T	10: 129,682,219	D173E	probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbm45	A	G	2: 76,375,424	S207G	probably benign	Het
Robo3	G	A	9: 37,422,181	Q723*	probably null	Het
Rreb1	G	T	13: 37,893,965	R51L	probably damaging	Het
Slc12a6	T	A	2: 112,267,030	L70Q	possibly damaging	Het
Slc15a2	A	G	16: 36,782,304	F65S	probably damaging	Het
Slitrk5	T	A	14: 111,679,797	C284*	probably null	Het
Smim17	G	T	7: 6,429,280	G74C	probably damaging	Het
Snapc4	G	A	2: 26,365,498	Q1005*	probably null	Het
Suv39h2	G	A	2: 3,464,808	T170I	probably benign	Het
Thrb	A	G	14: 18,033,551	K424R	probably damaging	Het
Tm4sf4	C	T	3: 57,437,745	Q191*	probably null	Het
Trak1	G	T	9: 121,442,797		probably null	Het
Ttn	A	G	2: 76,710,274	S25796P	probably damaging	Het
Ugp2	T	C	11: 21,353,366	R80G	probably benign	Het
Utp15	C	T	13: 98,259,166	V103I	probably benign	Het
Wdr3	A	T	3: 100,153,906	S249T	probably benign	Het
Zeb1	T	A	18: 5,748,743	D86E	probably damaging	Het

Other mutations in Mypn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00938:Mypn	APN	10	63192423	missense	probably damaging	1.00
IGL01137:Mypn	APN	10	63152854	missense	probably benign	0.12
IGL01383:Mypn	APN	10	63135797	missense	probably damaging	1.00
IGL01560:Mypn	APN	10	63134964	missense	probably benign	0.27
IGL01569:Mypn	APN	10	63127759	missense	probably damaging	1.00
IGL02197:Mypn	APN	10	63123278	missense	possibly damaging	0.69
IGL02829:Mypn	APN	10	63192586	missense	probably benign	0.01
IGL03221:Mypn	APN	10	63131123	missense	probably damaging	1.00
IGL03377:Mypn	APN	10	63192865	missense	probably benign	0.01
2107:Mypn	UTSW	10	63203751	utr 5 prime	probably benign
PIT4576001:Mypn	UTSW	10	63120071	missense	probably damaging	1.00
R0115:Mypn	UTSW	10	63192380	splice site	probably benign
R0377:Mypn	UTSW	10	63127622	unclassified	probably benign
R0480:Mypn	UTSW	10	63193203	missense	probably benign	0.01
R0581:Mypn	UTSW	10	63162244	missense	probably benign	0.06
R0669:Mypn	UTSW	10	63134923	splice site	probably benign
R0822:Mypn	UTSW	10	63169256	missense	probably damaging	1.00
R1209:Mypn	UTSW	10	63118499	missense	probably damaging	1.00
R1401:Mypn	UTSW	10	63152857	missense	probably damaging	0.96
R1513:Mypn	UTSW	10	63169368	missense	probably damaging	0.99
R1750:Mypn	UTSW	10	63136197	missense	probably benign	0.01
R1780:Mypn	UTSW	10	63121964	missense	probably damaging	1.00
R1791:Mypn	UTSW	10	63125693	missense	probably damaging	0.97
R1859:Mypn	UTSW	10	63146190	missense	probably benign
R1903:Mypn	UTSW	10	63123397	missense	probably benign	0.06
R2275:Mypn	UTSW	10	63131069	missense	probably damaging	1.00
R2420:Mypn	UTSW	10	63192869	nonsense	probably null
R3425:Mypn	UTSW	10	63118417	splice site	probably benign
R3767:Mypn	UTSW	10	63125707	missense	possibly damaging	0.88
R3768:Mypn	UTSW	10	63125707	missense	possibly damaging	0.88
R3770:Mypn	UTSW	10	63125707	missense	possibly damaging	0.88
R3777:Mypn	UTSW	10	63147982	missense	possibly damaging	0.92
R3785:Mypn	UTSW	10	63193182	missense	probably benign	0.43
R4289:Mypn	UTSW	10	63131182	missense	probably damaging	1.00
R4301:Mypn	UTSW	10	63118484	missense	probably damaging	1.00
R4366:Mypn	UTSW	10	63192708	missense	probably benign	0.00
R4459:Mypn	UTSW	10	63192432	missense	probably damaging	1.00
R4921:Mypn	UTSW	10	63147936	missense	possibly damaging	0.75
R4995:Mypn	UTSW	10	63119968	splice site	probably null
R5064:Mypn	UTSW	10	63123371	missense	possibly damaging	0.68
R5083:Mypn	UTSW	10	63118528	missense	probably damaging	0.98
R5108:Mypn	UTSW	10	63136294	missense	probably damaging	1.00
R5399:Mypn	UTSW	10	63120186	missense	probably benign	0.03
R5438:Mypn	UTSW	10	63135839	nonsense	probably null
R5590:Mypn	UTSW	10	63120048	missense	probably benign	0.27
R5652:Mypn	UTSW	10	63135801	missense	probably damaging	1.00
R5717:Mypn	UTSW	10	63127776	missense	probably damaging	1.00
R5970:Mypn	UTSW	10	63131023	missense	probably benign	0.36
R6616:Mypn	UTSW	10	63169312	missense	probably damaging	1.00
R6930:Mypn	UTSW	10	63116939	missense	probably damaging	1.00
R6987:Mypn	UTSW	10	63193131	missense	probably benign	0.00
R7020:Mypn	UTSW	10	63192510	missense	probably damaging	1.00
R7081:Mypn	UTSW	10	63134958	missense	probably damaging	1.00
R7477:Mypn	UTSW	10	63125721	missense	possibly damaging	0.89
R7534:Mypn	UTSW	10	63193131	missense	probably benign	0.00
R7853:Mypn	UTSW	10	63145873	missense	probably benign	0.00
R8367:Mypn	UTSW	10	63135760	missense	probably damaging	1.00
R8464:Mypn	UTSW	10	63131198	nonsense	probably null
R8750:Mypn	UTSW	10	63167257	missense	probably benign	0.00
R8947:Mypn	UTSW	10	63169377	missense	probably damaging	0.97
R8998:Mypn	UTSW	10	63162271	nonsense	probably null
R8999:Mypn	UTSW	10	63162271	nonsense	probably null
R9032:Mypn	UTSW	10	63148115	splice site	probably null
R9085:Mypn	UTSW	10	63148115	splice site	probably null
R9130:Mypn	UTSW	10	63192873	missense	probably benign	0.10
R9484:Mypn	UTSW	10	63167240	missense	probably benign	0.31
X0022:Mypn	UTSW	10	63136063	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCAACGATCATGGCAAACAG -3'
(R):5'- AAGGCTCACAGCTCCAAGAG -3'

Sequencing Primer
(F):5'- GAATTGCTAAACACTGCTCACTGG -3'
(R):5'- CTTTCTCAGATCTAACAGAAAGGCG -3'

Posted On

2015-04-30