Incidental Mutation 'R3888:Olfr802'
ID312871
Institutional Source Beutler Lab
Gene Symbol Olfr802
Ensembl Gene ENSMUSG00000093866
Gene Nameolfactory receptor 802
SynonymsGA_x6K02T2PULF-11361362-11360424, MOR111-1
MMRRC Submission 040800-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3888 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129677683-129688169 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129682219 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 173 (D173E)
Ref Sequence ENSEMBL: ENSMUSP00000074275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074713] [ENSMUST00000203785] [ENSMUST00000217576]
Predicted Effect probably benign
Transcript: ENSMUST00000074713
AA Change: D173E

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074275
Gene: ENSMUSG00000093866
AA Change: D173E

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 6.8e-56 PFAM
Pfam:7tm_1 39 288 2.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203785
AA Change: D173E

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000144741
Gene: ENSMUSG00000093866
AA Change: D173E

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 6.8e-56 PFAM
Pfam:7tm_1 39 288 2.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217576
AA Change: D173E

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
Acbd6 A G 1: 155,624,897 D201G probably damaging Het
Adam17 G A 12: 21,325,587 R744C probably damaging Het
Adss A G 1: 177,767,769 Y402H probably damaging Het
Ano3 T A 2: 110,885,000 K31I probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Cmya5 T G 13: 93,093,656 R1641S probably benign Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Frem1 T C 4: 82,913,607 R1991G probably benign Het
Gimap7 G A 6: 48,723,845 E122K probably benign Het
Hps3 A G 3: 20,003,223 probably null Het
Kctd2 A T 11: 115,427,519 K209N probably damaging Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Muc5ac T C 7: 141,791,224 V144A possibly damaging Het
Mypn T C 10: 63,192,510 Y258C probably damaging Het
Ntf3 T C 6: 126,102,442 M21V probably benign Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Olfr1447 A T 19: 12,901,133 C216S probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Robo3 G A 9: 37,422,181 Q723* probably null Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Slc12a6 T A 2: 112,267,030 L70Q possibly damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Smim17 G T 7: 6,429,280 G74C probably damaging Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Suv39h2 G A 2: 3,464,808 T170I probably benign Het
Thrb A G 14: 18,033,551 K424R probably damaging Het
Tm4sf4 C T 3: 57,437,745 Q191* probably null Het
Trak1 G T 9: 121,442,797 probably null Het
Ttn A G 2: 76,710,274 S25796P probably damaging Het
Ugp2 T C 11: 21,353,366 R80G probably benign Het
Utp15 C T 13: 98,259,166 V103I probably benign Het
Wdr3 A T 3: 100,153,906 S249T probably benign Het
Zeb1 T A 18: 5,748,743 D86E probably damaging Het
Other mutations in Olfr802
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02939:Olfr802 APN 10 129681988 nonsense probably null
IGL03112:Olfr802 APN 10 129681923 missense probably benign 0.08
R0366:Olfr802 UTSW 10 129681971 missense possibly damaging 0.72
R0463:Olfr802 UTSW 10 129681839 missense probably benign 0.11
R0579:Olfr802 UTSW 10 129682237 nonsense probably null
R1769:Olfr802 UTSW 10 129682212 missense probably benign 0.15
R2128:Olfr802 UTSW 10 129682532 missense possibly damaging 0.78
R2375:Olfr802 UTSW 10 129682163 missense probably benign 0.04
R3888:Olfr802 UTSW 10 129682218 missense possibly damaging 0.94
R4956:Olfr802 UTSW 10 129682099 missense probably benign 0.00
R5471:Olfr802 UTSW 10 129682056 missense probably damaging 1.00
R5588:Olfr802 UTSW 10 129681836 missense possibly damaging 0.72
R7305:Olfr802 UTSW 10 129682280 missense probably damaging 0.99
R7995:Olfr802 UTSW 10 129682640 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGTGGAAAAGGCCTTTGAC -3'
(R):5'- TGGGAGTCACTGAATTTTACCTTC -3'

Sequencing Primer
(F):5'- GAAAAGGCCTTTGACCTCTGACTG -3'
(R):5'- TAGCTGCCATGTCCTATGACCG -3'
Posted On2015-04-30