Incidental Mutation 'R3888:Utp15'
ID312878
Institutional Source Beutler Lab
Gene Symbol Utp15
Ensembl Gene ENSMUSG00000041747
Gene NameUTP15 small subunit processome component
Synonyms
MMRRC Submission 040800-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R3888 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location98246845-98263041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98259166 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 103 (V103I)
Ref Sequence ENSEMBL: ENSMUSP00000048204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022164] [ENSMUST00000040972] [ENSMUST00000091356] [ENSMUST00000123924] [ENSMUST00000150352] [ENSMUST00000150916] [ENSMUST00000226100]
Predicted Effect probably benign
Transcript: ENSMUST00000022164
SMART Domains Protein: ENSMUSP00000022164
Gene: ENSMUSG00000021661

DomainStartEndE-ValueType
ANK 180 209 1.45e-6 SMART
ANK 213 242 1.05e-3 SMART
ANK 246 275 1.76e-5 SMART
Blast:ANK 279 308 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000040972
AA Change: V103I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000048204
Gene: ENSMUSG00000041747
AA Change: V103I

DomainStartEndE-ValueType
WD40 31 66 6.85e1 SMART
WD40 69 108 1.66e-5 SMART
WD40 111 150 2.82e-8 SMART
WD40 153 193 7.33e-7 SMART
WD40 196 233 3.9e-2 SMART
WD40 237 276 1.39e-7 SMART
WD40 279 317 1.7e2 SMART
Pfam:UTP15_C 343 490 3.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091356
SMART Domains Protein: ENSMUSP00000088915
Gene: ENSMUSG00000021661

DomainStartEndE-ValueType
ANK 20 49 1.45e-6 SMART
ANK 53 82 1.05e-3 SMART
ANK 86 115 1.76e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123924
SMART Domains Protein: ENSMUSP00000122701
Gene: ENSMUSG00000021661

DomainStartEndE-ValueType
ANK 180 209 1.45e-6 SMART
ANK 213 242 1.05e-3 SMART
ANK 246 275 1.76e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150352
SMART Domains Protein: ENSMUSP00000117508
Gene: ENSMUSG00000021661

DomainStartEndE-ValueType
ANK 180 209 1.45e-6 SMART
ANK 213 242 1.05e-3 SMART
ANK 246 275 1.76e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150916
SMART Domains Protein: ENSMUSP00000116590
Gene: ENSMUSG00000021661

DomainStartEndE-ValueType
ANK 20 49 1.45e-6 SMART
ANK 53 82 1.05e-3 SMART
ANK 86 115 1.76e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224842
Predicted Effect probably benign
Transcript: ENSMUST00000226100
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T A 1: 85,940,551 probably null Het
Acbd6 A G 1: 155,624,897 D201G probably damaging Het
Adam17 G A 12: 21,325,587 R744C probably damaging Het
Adss A G 1: 177,767,769 Y402H probably damaging Het
Ano3 T A 2: 110,885,000 K31I probably damaging Het
B930094E09Rik G A 18: 31,609,689 S59N unknown Het
Cmya5 T G 13: 93,093,656 R1641S probably benign Het
Cps1 C A 1: 67,165,500 T493K possibly damaging Het
Dmxl1 T A 18: 49,878,259 M1161K probably damaging Het
Etl4 C T 2: 20,529,961 Q76* probably null Het
Fn1 T C 1: 71,640,306 Y511C probably damaging Het
Foxd2 T C 4: 114,908,286 H179R unknown Het
Frem1 T C 4: 82,913,607 R1991G probably benign Het
Gimap7 G A 6: 48,723,845 E122K probably benign Het
Hps3 A G 3: 20,003,223 probably null Het
Kctd2 A T 11: 115,427,519 K209N probably damaging Het
Lcor T A 19: 41,558,356 S126R probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Muc5ac T C 7: 141,791,224 V144A possibly damaging Het
Mypn T C 10: 63,192,510 Y258C probably damaging Het
Ntf3 T C 6: 126,102,442 M21V probably benign Het
Olfr1243 T A 2: 89,527,732 H226L possibly damaging Het
Olfr1447 A T 19: 12,901,133 C216S probably benign Het
Olfr802 G A 10: 129,682,218 H174Y possibly damaging Het
Olfr802 A T 10: 129,682,219 D173E probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbm45 A G 2: 76,375,424 S207G probably benign Het
Robo3 G A 9: 37,422,181 Q723* probably null Het
Rreb1 G T 13: 37,893,965 R51L probably damaging Het
Slc12a6 T A 2: 112,267,030 L70Q possibly damaging Het
Slc15a2 A G 16: 36,782,304 F65S probably damaging Het
Slitrk5 T A 14: 111,679,797 C284* probably null Het
Smim17 G T 7: 6,429,280 G74C probably damaging Het
Snapc4 G A 2: 26,365,498 Q1005* probably null Het
Suv39h2 G A 2: 3,464,808 T170I probably benign Het
Thrb A G 14: 18,033,551 K424R probably damaging Het
Tm4sf4 C T 3: 57,437,745 Q191* probably null Het
Trak1 G T 9: 121,442,797 probably null Het
Ttn A G 2: 76,710,274 S25796P probably damaging Het
Ugp2 T C 11: 21,353,366 R80G probably benign Het
Wdr3 A T 3: 100,153,906 S249T probably benign Het
Zeb1 T A 18: 5,748,743 D86E probably damaging Het
Other mutations in Utp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02951:Utp15 APN 13 98257952 missense probably damaging 1.00
IGL02960:Utp15 APN 13 98252881 missense probably benign 0.30
IGL03271:Utp15 APN 13 98253694 missense probably damaging 1.00
R0125:Utp15 UTSW 13 98250882 missense possibly damaging 0.81
R0679:Utp15 UTSW 13 98259403 missense probably benign 0.13
R1447:Utp15 UTSW 13 98252878 missense possibly damaging 0.68
R1618:Utp15 UTSW 13 98257187 missense probably benign 0.16
R1992:Utp15 UTSW 13 98250912 missense probably benign
R2110:Utp15 UTSW 13 98254985 missense probably damaging 1.00
R2263:Utp15 UTSW 13 98257925 missense probably benign 0.03
R4355:Utp15 UTSW 13 98259247 missense possibly damaging 0.48
R5436:Utp15 UTSW 13 98260846 splice site probably null
R5568:Utp15 UTSW 13 98257925 missense probably benign 0.03
R6489:Utp15 UTSW 13 98250609 missense probably damaging 0.96
R8116:Utp15 UTSW 13 98250863 missense probably benign
R8360:Utp15 UTSW 13 98254991 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTATGAACTGGATGGTAGAACTAGG -3'
(R):5'- ACAGGATTTTCTGTTGAGCCATC -3'

Sequencing Primer
(F):5'- GAACTAGGGTTAAGTTCTTTGTGAAC -3'
(R):5'- TGAGCCATCTAGTGAAATCCTGG -3'
Posted On2015-04-30