Mutagenetix > Incidental Mutations

Incidental Mutation 'R3888:Olfr1447'

312886

Institutional Source

Beutler Lab

Gene Symbol

Olfr1447

Ensembl Gene

ENSMUSG00000060303

Gene Name

olfactory receptor 1447

Synonyms

GA_x6K02T2RE5P-3231251-3230331, MOR202-3

MMRRC Submission

040800-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.063) question?

Stock #

R3888 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12899434-12903743 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 12901133 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 216 (C216S)

Ref Sequence

ENSEMBL: ENSMUSP00000149392 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071484] [ENSMUST00000208343] [ENSMUST00000216989]

Predicted Effect

probably benign
Transcript: ENSMUST00000071484
AA Change: C216S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000071419
Gene: ENSMUSG00000060303
AA Change: C216S

Domain	Start	End	E-Value	Type
Pfam:7tm_4	32	309	5.3e-50	PFAM
Pfam:7TM_GPCR_Srsx	36	306	2.1e-7	PFAM
Pfam:7tm_1	42	291	7.4e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000208343

Predicted Effect

probably benign
Transcript: ENSMUST00000216989
AA Change: C216S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218013

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220222

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933407L21Rik	T	A	1: 85,940,551		probably null	Het
Acbd6	A	G	1: 155,624,897	D201G	probably damaging	Het
Adam17	G	A	12: 21,325,587	R744C	probably damaging	Het
Adss	A	G	1: 177,767,769	Y402H	probably damaging	Het
Ano3	T	A	2: 110,885,000	K31I	probably damaging	Het
B930094E09Rik	G	A	18: 31,609,689	S59N	unknown	Het
Cmya5	T	G	13: 93,093,656	R1641S	probably benign	Het
Cps1	C	A	1: 67,165,500	T493K	possibly damaging	Het
Dmxl1	T	A	18: 49,878,259	M1161K	probably damaging	Het
Etl4	C	T	2: 20,529,961	Q76*	probably null	Het
Fn1	T	C	1: 71,640,306	Y511C	probably damaging	Het
Foxd2	T	C	4: 114,908,286	H179R	unknown	Het
Frem1	T	C	4: 82,913,607	R1991G	probably benign	Het
Gimap7	G	A	6: 48,723,845	E122K	probably benign	Het
Hps3	A	G	3: 20,003,223		probably null	Het
Kctd2	A	T	11: 115,427,519	K209N	probably damaging	Het
Lcor	T	A	19: 41,558,356	S126R	probably damaging	Het
Lct	T	C	1: 128,304,226	M629V	probably damaging	Het
Lrp5	G	A	19: 3,612,330	R173C	probably damaging	Het
Muc5ac	T	C	7: 141,791,224	V144A	possibly damaging	Het
Mypn	T	C	10: 63,192,510	Y258C	probably damaging	Het
Ntf3	T	C	6: 126,102,442	M21V	probably benign	Het
Olfr1243	T	A	2: 89,527,732	H226L	possibly damaging	Het
Olfr802	G	A	10: 129,682,218	H174Y	possibly damaging	Het
Olfr802	A	T	10: 129,682,219	D173E	probably benign	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rbm45	A	G	2: 76,375,424	S207G	probably benign	Het
Robo3	G	A	9: 37,422,181	Q723*	probably null	Het
Rreb1	G	T	13: 37,893,965	R51L	probably damaging	Het
Slc12a6	T	A	2: 112,267,030	L70Q	possibly damaging	Het
Slc15a2	A	G	16: 36,782,304	F65S	probably damaging	Het
Slitrk5	T	A	14: 111,679,797	C284*	probably null	Het
Smim17	G	T	7: 6,429,280	G74C	probably damaging	Het
Snapc4	G	A	2: 26,365,498	Q1005*	probably null	Het
Suv39h2	G	A	2: 3,464,808	T170I	probably benign	Het
Thrb	A	G	14: 18,033,551	K424R	probably damaging	Het
Tm4sf4	C	T	3: 57,437,745	Q191*	probably null	Het
Trak1	G	T	9: 121,442,797		probably null	Het
Ttn	A	G	2: 76,710,274	S25796P	probably damaging	Het
Ugp2	T	C	11: 21,353,366	R80G	probably benign	Het
Utp15	C	T	13: 98,259,166	V103I	probably benign	Het
Wdr3	A	T	3: 100,153,906	S249T	probably benign	Het
Zeb1	T	A	18: 5,748,743	D86E	probably damaging	Het

Other mutations in Olfr1447

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Olfr1447	APN	19	12901355	missense	probably benign	0.40
IGL01704:Olfr1447	APN	19	12901739	missense	probably benign	0.01
IGL01767:Olfr1447	APN	19	12901748	missense	probably benign	0.12
IGL01969:Olfr1447	APN	19	12901052	missense	possibly damaging	0.69
IGL02435:Olfr1447	APN	19	12901027	missense	probably damaging	1.00
IGL02666:Olfr1447	APN	19	12900857	missense	probably benign
IGL03034:Olfr1447	APN	19	12901757	missense	possibly damaging	0.94
IGL03221:Olfr1447	APN	19	12901541	missense	probably damaging	1.00
R0315:Olfr1447	UTSW	19	12901234	missense	possibly damaging	0.66
R0550:Olfr1447	UTSW	19	12901800	splice site	probably null
R0729:Olfr1447	UTSW	19	12900895	missense	probably damaging	0.97
R1381:Olfr1447	UTSW	19	12900956	missense	probably benign	0.00
R1669:Olfr1447	UTSW	19	12901288	missense	possibly damaging	0.79
R1775:Olfr1447	UTSW	19	12901235	missense	probably benign	0.02
R1918:Olfr1447	UTSW	19	12900851	makesense	probably null
R2377:Olfr1447	UTSW	19	12900853	missense	possibly damaging	0.45
R2406:Olfr1447	UTSW	19	12901627	missense	probably benign	0.11
R2471:Olfr1447	UTSW	19	12901315	missense	probably benign	0.00
R2484:Olfr1447	UTSW	19	12901641	missense	probably benign	0.06
R2656:Olfr1447	UTSW	19	12901666	missense	probably benign	0.37
R4250:Olfr1447	UTSW	19	12901004	missense	probably benign	0.09
R4545:Olfr1447	UTSW	19	12901268	nonsense	probably null
R4895:Olfr1447	UTSW	19	12900887	missense	probably damaging	1.00
R4956:Olfr1447	UTSW	19	12901599	missense	probably damaging	0.99
R4991:Olfr1447	UTSW	19	12901451	missense	probably damaging	0.98
R5044:Olfr1447	UTSW	19	12901001	missense	probably damaging	1.00
R5165:Olfr1447	UTSW	19	12901200	missense	probably benign	0.00
R6025:Olfr1447	UTSW	19	12901670	missense	probably benign	0.10
R6135:Olfr1447	UTSW	19	12901439	missense	probably damaging	0.97
R6459:Olfr1447	UTSW	19	12901005	missense	possibly damaging	0.94
R6733:Olfr1447	UTSW	19	12901241	missense	probably damaging	1.00
R6789:Olfr1447	UTSW	19	12901289	missense	probably benign	0.21
R6923:Olfr1447	UTSW	19	12901312	missense	probably benign	0.04
R7310:Olfr1447	UTSW	19	12901273	missense	probably damaging	1.00
R8552:Olfr1447	UTSW	19	12901732	missense	probably damaging	0.98
R8699:Olfr1447	UTSW	19	12901464	missense	possibly damaging	0.59
R8735:Olfr1447	UTSW	19	12900910	missense	possibly damaging	0.85
R8955:Olfr1447	UTSW	19	12901214	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCCTCAGGCTGTAGACTAGAGG -3'
(R):5'- AATTCCTCCATCCATATTGCAGAC -3'

Sequencing Primer
(F):5'- CTCAGGCTGTAGACTAGAGGATTCAG -3'
(R):5'- TCCATCCATATTGCAGACATATTCAC -3'

Posted On

2015-04-30