Mutagenetix > Incidental Mutation

Incidental Mutation 'R3942:Zp3r'

312889

Institutional Source

Beutler Lab

Gene Symbol

Zp3r

Ensembl Gene

ENSMUSG00000042554

Gene Name

zona pellucida 3 receptor

Synonyms

SP56

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R3942 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

130576713-130629621 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 130577054 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 470 (D470E)

Ref Sequence

ENSEMBL: ENSMUSP00000118784 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039862] [ENSMUST00000128128] [ENSMUST00000142416]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000039862
AA Change: D535E

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000045443
Gene: ENSMUSG00000042554
AA Change: D535E

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
CCP	34	91	2.52e-7	SMART
CCP	96	153	3.17e-13	SMART
CCP	158	218	8.23e-12	SMART
CCP	223	278	1.77e-11	SMART
CCP	283	345	5.32e-6	SMART
CCP	350	411	3.67e-9	SMART
CCP	456	509	6.95e-10	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000128128
AA Change: D491E

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000114401
Gene: ENSMUSG00000042554
AA Change: D491E

Domain	Start	End	E-Value	Type
CCP	55	112	2.52e-7	SMART
CCP	117	174	3.17e-13	SMART
CCP	179	234	1.77e-11	SMART
CCP	239	301	5.32e-6	SMART
CCP	306	367	3.67e-9	SMART
CCP	412	465	6.95e-10	SMART
PDB:4B0F\|G	468	513	8e-8	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000142416
AA Change: D470E

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000118784
Gene: ENSMUSG00000042554
AA Change: D470E

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
CCP	34	91	2.52e-7	SMART
CCP	96	153	3.17e-13	SMART
CCP	158	213	1.77e-11	SMART
CCP	218	280	5.32e-6	SMART
CCP	285	346	3.67e-9	SMART
CCP	391	444	6.95e-10	SMART
PDB:4B0F\|G	447	492	8e-8	PDB

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal fertility and sperm morphology and physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	T	C	13: 81,182,789	N6049S	probably damaging	Het
Aph1a	C	T	3: 95,894,261	R31W	probably damaging	Het
Atp10b	T	C	11: 43,172,754	V172A	probably damaging	Het
Atp13a2	T	C	4: 141,006,422	S1041P	probably damaging	Het
Best3	T	A	10: 116,988,674	F15Y	possibly damaging	Het
Brinp3	C	A	1: 146,751,861	D277E	probably damaging	Het
Crb1	A	C	1: 139,337,473	L69R	possibly damaging	Het
Crcp	T	C	5: 130,034,950		probably null	Het
Dysf	G	A	6: 84,186,509		probably null	Het
Gm5724	A	G	6: 141,727,714	I366T	probably damaging	Het
Hps3	T	C	3: 19,996,939	Y859C	probably damaging	Het
Irx5	C	A	8: 92,359,686	N132K	probably damaging	Het
Itgb2	A	G	10: 77,558,033	T436A	probably benign	Het
Kit	A	G	5: 75,609,318	D130G	probably benign	Het
Krt12	A	G	11: 99,422,096	S41P	unknown	Het
Lypd6b	G	T	2: 49,943,540	S64I	probably damaging	Het
Mpc1	T	A	17: 8,288,588		probably null	Het
Olfr1214	T	A	2: 88,988,111	L30F	probably benign	Het
Olfr1443	A	T	19: 12,680,404	M99L	probably benign	Het
Pard3b	T	A	1: 62,159,452	I233N	probably damaging	Het
Pcdh1	A	G	18: 38,199,458	V164A	probably benign	Het
Pclo	A	G	5: 14,679,918		probably benign	Het
Pkhd1l1	T	C	15: 44,592,026		probably null	Het
Spata31d1d	T	C	13: 59,727,462	Q753R	probably benign	Het
Stxbp6	A	G	12: 44,902,858		probably null	Het
Trav6-5	T	C	14: 53,491,381	S32P	probably benign	Het

Other mutations in Zp3r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01352:Zp3r	APN	1	130619356	missense	possibly damaging	0.88
IGL01783:Zp3r	APN	1	130598866	missense	possibly damaging	0.72
IGL01820:Zp3r	APN	1	130598920	missense	probably benign	0.01
IGL01959:Zp3r	APN	1	130591451	nonsense	probably null
IGL01978:Zp3r	APN	1	130598941	missense	probably damaging	1.00
IGL02232:Zp3r	APN	1	130596667	missense	probably damaging	1.00
IGL02290:Zp3r	APN	1	130619365	missense	possibly damaging	0.89
IGL02878:Zp3r	APN	1	130582851	missense	probably benign	0.02
IGL02960:Zp3r	APN	1	130583438	missense	possibly damaging	0.67
BB006:Zp3r	UTSW	1	130591480	missense	probably benign	0.31
BB016:Zp3r	UTSW	1	130591480	missense	probably benign	0.31
PIT4403001:Zp3r	UTSW	1	130582872	missense	possibly damaging	0.93
R0433:Zp3r	UTSW	1	130577133	splice site	probably benign
R0491:Zp3r	UTSW	1	130618334	missense	probably damaging	1.00
R0781:Zp3r	UTSW	1	130577884	critical splice donor site	probably null
R1110:Zp3r	UTSW	1	130577884	critical splice donor site	probably null
R1126:Zp3r	UTSW	1	130618342	missense	probably damaging	1.00
R1295:Zp3r	UTSW	1	130591444	missense	probably damaging	1.00
R1680:Zp3r	UTSW	1	130582880	missense	probably benign	0.15
R1728:Zp3r	UTSW	1	130596814	missense	probably benign	0.00
R1728:Zp3r	UTSW	1	130619414	missense	possibly damaging	0.68
R1729:Zp3r	UTSW	1	130596814	missense	probably benign	0.00
R1729:Zp3r	UTSW	1	130619414	missense	possibly damaging	0.68
R1730:Zp3r	UTSW	1	130596814	missense	probably benign	0.00
R1730:Zp3r	UTSW	1	130619414	missense	possibly damaging	0.68
R1739:Zp3r	UTSW	1	130596814	missense	probably benign	0.00
R1739:Zp3r	UTSW	1	130619414	missense	possibly damaging	0.68
R1762:Zp3r	UTSW	1	130596814	missense	probably benign	0.00
R1762:Zp3r	UTSW	1	130619414	missense	possibly damaging	0.68
R1783:Zp3r	UTSW	1	130596814	missense	probably benign	0.00
R1783:Zp3r	UTSW	1	130619414	missense	possibly damaging	0.68
R1784:Zp3r	UTSW	1	130596814	missense	probably benign	0.00
R1784:Zp3r	UTSW	1	130619414	missense	possibly damaging	0.68
R1785:Zp3r	UTSW	1	130596814	missense	probably benign	0.00
R1785:Zp3r	UTSW	1	130619414	missense	possibly damaging	0.68
R4429:Zp3r	UTSW	1	130591391	missense	possibly damaging	0.95
R4571:Zp3r	UTSW	1	130578020	missense	probably damaging	1.00
R4626:Zp3r	UTSW	1	130615175	missense	probably damaging	1.00
R4647:Zp3r	UTSW	1	130577960	missense	probably damaging	1.00
R4790:Zp3r	UTSW	1	130582892	missense	probably damaging	1.00
R4815:Zp3r	UTSW	1	130598912	missense	probably damaging	1.00
R5355:Zp3r	UTSW	1	130596781	missense	probably benign	0.09
R5554:Zp3r	UTSW	1	130583471	missense	probably benign	0.42
R5629:Zp3r	UTSW	1	130582879	missense	probably damaging	0.99
R6154:Zp3r	UTSW	1	130598905	missense	probably damaging	1.00
R6173:Zp3r	UTSW	1	130591568	splice site	probably null
R6949:Zp3r	UTSW	1	130577895	missense	probably benign	0.00
R7346:Zp3r	UTSW	1	130583480	missense	probably benign	0.02
R7399:Zp3r	UTSW	1	130577053	missense	probably damaging	0.98
R7929:Zp3r	UTSW	1	130591480	missense	probably benign	0.31
R7944:Zp3r	UTSW	1	130596823	missense	probably damaging	1.00
R7945:Zp3r	UTSW	1	130596823	missense	probably damaging	1.00
R8367:Zp3r	UTSW	1	130598873	missense	probably damaging	1.00
R8742:Zp3r	UTSW	1	130583493	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGTTCTTCTGGCCCCAAAAC -3'
(R):5'- GGATGCAAAGTCTCTCCTGATTC -3'

Sequencing Primer
(F):5'- CCCAAAACCTTTTAACAGGAGTGGTG -3'
(R):5'- GCAAAGTCTCTCCTGATTCTCTCTC -3'

Posted On

2015-04-30