Mutagenetix > Incidental Mutation

Incidental Mutation 'R3942:Brinp3'

312891

Institutional Source

Beutler Lab

Gene Symbol

Brinp3

Ensembl Gene

ENSMUSG00000035131

Gene Name

bone morphogenetic protein/retinoic acid inducible neural specific 3

Synonyms

Fam5c, B830045N13Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.206) question?

Stock #

R3942 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

146494760-146902472 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 146751861 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 277 (D277E)

Ref Sequence

ENSEMBL: ENSMUSP00000126074 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074622] [ENSMUST00000128345] [ENSMUST00000132847] [ENSMUST00000166814]

AlphaFold

Q499E0

Predicted Effect

probably damaging
Transcript: ENSMUST00000074622
AA Change: D277E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000074201
Gene: ENSMUSG00000035131
AA Change: D277E

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128345

SMART Domains

Protein: ENSMUSP00000116763
Gene: ENSMUSG00000035131

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132847

SMART Domains

Protein: ENSMUSP00000118552
Gene: ENSMUSG00000035131

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Blast:MACPF	78	110	1e-16	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000166814
AA Change: D277E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126074
Gene: ENSMUSG00000035131
AA Change: D277E

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Meta Mutation Damage Score

0.1478

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is overexpressed in pituitary tumors but is underexpressed in tongue squamous cell carcinomas, ulcerative colitis, and peri-implantitis. Polymorphisms that increase expression of this gene have been shown to increase vascular inflammation, and an association of this gene with myocardial infarction has been demonstrated. Finally, hypermethylation of this gene may find usefulness as a biomarker for gastric cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	T	C	13: 81,182,789	N6049S	probably damaging	Het
Aph1a	C	T	3: 95,894,261	R31W	probably damaging	Het
Atp10b	T	C	11: 43,172,754	V172A	probably damaging	Het
Atp13a2	T	C	4: 141,006,422	S1041P	probably damaging	Het
Best3	T	A	10: 116,988,674	F15Y	possibly damaging	Het
Crb1	A	C	1: 139,337,473	L69R	possibly damaging	Het
Crcp	T	C	5: 130,034,950		probably null	Het
Dysf	G	A	6: 84,186,509		probably null	Het
Gm5724	A	G	6: 141,727,714	I366T	probably damaging	Het
Hps3	T	C	3: 19,996,939	Y859C	probably damaging	Het
Irx5	C	A	8: 92,359,686	N132K	probably damaging	Het
Itgb2	A	G	10: 77,558,033	T436A	probably benign	Het
Kit	A	G	5: 75,609,318	D130G	probably benign	Het
Krt12	A	G	11: 99,422,096	S41P	unknown	Het
Lypd6b	G	T	2: 49,943,540	S64I	probably damaging	Het
Mpc1	T	A	17: 8,288,588		probably null	Het
Olfr1214	T	A	2: 88,988,111	L30F	probably benign	Het
Olfr1443	A	T	19: 12,680,404	M99L	probably benign	Het
Pard3b	T	A	1: 62,159,452	I233N	probably damaging	Het
Pcdh1	A	G	18: 38,199,458	V164A	probably benign	Het
Pclo	A	G	5: 14,679,918		probably benign	Het
Pkhd1l1	T	C	15: 44,592,026		probably null	Het
Spata31d1d	T	C	13: 59,727,462	Q753R	probably benign	Het
Stxbp6	A	G	12: 44,902,858		probably null	Het
Trav6-5	T	C	14: 53,491,381	S32P	probably benign	Het
Zp3r	A	C	1: 130,577,054	D470E	possibly damaging	Het

Other mutations in Brinp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Brinp3	APN	1	146901774	missense	probably damaging	0.99
IGL00503:Brinp3	APN	1	146901167	missense	probably benign
IGL01702:Brinp3	APN	1	146751997	splice site	probably benign
IGL01728:Brinp3	APN	1	146831551	splice site	probably null
IGL01733:Brinp3	APN	1	146514803	missense	probably benign	0.33
IGL01937:Brinp3	APN	1	146901140	missense	probably benign
IGL02020:Brinp3	APN	1	146902127	utr 3 prime	probably benign
IGL02082:Brinp3	APN	1	146751862	missense	probably damaging	1.00
IGL02365:Brinp3	APN	1	146901122	missense	probably benign	0.00
IGL02366:Brinp3	APN	1	146701743	missense	possibly damaging	0.84
IGL02565:Brinp3	APN	1	146902032	missense	probably damaging	0.98
IGL02999:Brinp3	APN	1	146701849	splice site	probably null
IGL03099:Brinp3	APN	1	146902097	missense	possibly damaging	0.91
PIT4283001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
PIT4418001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0266:Brinp3	UTSW	1	146682680	nonsense	probably null
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1522:Brinp3	UTSW	1	146901890	missense	probably damaging	0.99
R1596:Brinp3	UTSW	1	146514782	missense	probably benign
R1898:Brinp3	UTSW	1	146901249	missense	possibly damaging	0.93
R2036:Brinp3	UTSW	1	146701841	missense	possibly damaging	0.84
R2224:Brinp3	UTSW	1	146901920	nonsense	probably null
R2272:Brinp3	UTSW	1	146901404	missense	possibly damaging	0.93
R2291:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R2322:Brinp3	UTSW	1	146701754	missense	probably benign
R2880:Brinp3	UTSW	1	146902002	missense	probably damaging	0.98
R3918:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3939:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3940:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3941:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R4095:Brinp3	UTSW	1	146901692	missense	possibly damaging	0.72
R4783:Brinp3	UTSW	1	146727640	intron	probably benign
R5009:Brinp3	UTSW	1	146901049	missense	probably benign	0.25
R5034:Brinp3	UTSW	1	146727720	intron	probably benign
R5166:Brinp3	UTSW	1	146901367	missense	probably damaging	0.96
R5372:Brinp3	UTSW	1	146831726	missense	probably damaging	1.00
R5472:Brinp3	UTSW	1	146901459	missense	possibly damaging	0.86
R5651:Brinp3	UTSW	1	146701799	missense	probably benign	0.01
R5681:Brinp3	UTSW	1	146901746	missense	probably benign	0.12
R6351:Brinp3	UTSW	1	146901585	missense	probably damaging	0.96
R6470:Brinp3	UTSW	1	146901906	missense	probably damaging	0.99
R6499:Brinp3	UTSW	1	146901693	missense	possibly damaging	0.86
R7078:Brinp3	UTSW	1	146514889	nonsense	probably null
R7223:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R7322:Brinp3	UTSW	1	146682688	nonsense	probably null
R7347:Brinp3	UTSW	1	146902086	missense	probably benign	0.22
R7375:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7412:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7532:Brinp3	UTSW	1	146901401	missense	probably damaging	0.98
R7562:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7576:Brinp3	UTSW	1	146901563	missense	probably damaging	0.99
R7723:Brinp3	UTSW	1	146701671	missense	probably damaging	1.00
R7737:Brinp3	UTSW	1	146682594	missense	probably damaging	0.98
R7793:Brinp3	UTSW	1	146746568	missense	probably benign	0.20
R8334:Brinp3	UTSW	1	146902053	missense	probably damaging	0.99
R8401:Brinp3	UTSW	1	146901446	missense	probably benign	0.17
R9205:Brinp3	UTSW	1	146902089	missense	possibly damaging	0.57
R9328:Brinp3	UTSW	1	146831717	missense	probably damaging	0.98
R9602:Brinp3	UTSW	1	146746496	missense	probably damaging	1.00
X0060:Brinp3	UTSW	1	146901786	missense	probably benign	0.01
Z1176:Brinp3	UTSW	1	146902076	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCTTCTCTACTCAGGGTGTTGTAAAC -3'
(R):5'- GTTTCAACAGGAGCAATCAGTCC -3'

Sequencing Primer
(F):5'- CTACTCAGGGTGTTGTAAACAAGTGC -3'
(R):5'- TCGTATTTTTGGGGCAAGACACAC -3'

Posted On

2015-04-30