Incidental Mutation 'R3942:Lypd6b'
ID312892
Institutional Source Beutler Lab
Gene Symbol Lypd6b
Ensembl Gene ENSMUSG00000026765
Gene NameLY6/PLAUR domain containing 6B
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3942 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location49787688-49948849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 49943540 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 64 (S64I)
Ref Sequence ENSEMBL: ENSMUSP00000028103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028103]
Predicted Effect probably damaging
Transcript: ENSMUST00000028103
AA Change: S64I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028103
Gene: ENSMUSG00000026765
AA Change: S64I

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
LU 65 156 7.64e-2 SMART
low complexity region 167 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129867
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,182,789 N6049S probably damaging Het
Aph1a C T 3: 95,894,261 R31W probably damaging Het
Atp10b T C 11: 43,172,754 V172A probably damaging Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Best3 T A 10: 116,988,674 F15Y possibly damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Crb1 A C 1: 139,337,473 L69R possibly damaging Het
Crcp T C 5: 130,034,950 probably null Het
Dysf G A 6: 84,186,509 probably null Het
Gm5724 A G 6: 141,727,714 I366T probably damaging Het
Hps3 T C 3: 19,996,939 Y859C probably damaging Het
Irx5 C A 8: 92,359,686 N132K probably damaging Het
Itgb2 A G 10: 77,558,033 T436A probably benign Het
Kit A G 5: 75,609,318 D130G probably benign Het
Krt12 A G 11: 99,422,096 S41P unknown Het
Mpc1 T A 17: 8,288,588 probably null Het
Olfr1214 T A 2: 88,988,111 L30F probably benign Het
Olfr1443 A T 19: 12,680,404 M99L probably benign Het
Pard3b T A 1: 62,159,452 I233N probably damaging Het
Pcdh1 A G 18: 38,199,458 V164A probably benign Het
Pclo A G 5: 14,679,918 probably benign Het
Pkhd1l1 T C 15: 44,592,026 probably null Het
Spata31d1d T C 13: 59,727,462 Q753R probably benign Het
Stxbp6 A G 12: 44,902,858 probably null Het
Trav6-5 T C 14: 53,491,381 S32P probably benign Het
Zp3r A C 1: 130,577,054 D470E possibly damaging Het
Other mutations in Lypd6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Lypd6b APN 2 49943630 splice site probably benign
R1056:Lypd6b UTSW 2 49947456 missense possibly damaging 0.89
R1174:Lypd6b UTSW 2 49943597 missense possibly damaging 0.89
R1510:Lypd6b UTSW 2 49934819 missense probably damaging 0.98
R1518:Lypd6b UTSW 2 49947492 missense probably damaging 0.99
R1550:Lypd6b UTSW 2 49943603 missense probably damaging 1.00
R1864:Lypd6b UTSW 2 49947447 missense possibly damaging 0.95
R4942:Lypd6b UTSW 2 49946120 missense probably benign 0.25
R5988:Lypd6b UTSW 2 49946166 missense probably damaging 1.00
R7329:Lypd6b UTSW 2 49942500 missense probably benign 0.09
R7944:Lypd6b UTSW 2 49943600 missense probably damaging 1.00
R7945:Lypd6b UTSW 2 49943600 missense probably damaging 1.00
Z1177:Lypd6b UTSW 2 49942596 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGAGCCATTTCATTTCAGGAC -3'
(R):5'- GATCCAGGACCCCATTAGAATC -3'

Sequencing Primer
(F):5'- GAGCCATTTCATTTCAGGACACAGG -3'
(R):5'- ATTAGAATCCCACTGGCCTGTG -3'
Posted On2015-04-30