Incidental Mutation 'R3942:Hps3'
ID312894
Institutional Source Beutler Lab
Gene Symbol Hps3
Ensembl Gene ENSMUSG00000027615
Gene NameHPS3, biogenesis of lysosomal organelles complex 2 subunit 1
Synonymscoa, cocoa
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R3942 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location19995945-20035315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19996939 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 859 (Y859C)
Ref Sequence ENSEMBL: ENSMUSP00000103957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003714] [ENSMUST00000012580] [ENSMUST00000091309] [ENSMUST00000108321] [ENSMUST00000108325] [ENSMUST00000108328] [ENSMUST00000108329] [ENSMUST00000173779]
Predicted Effect probably benign
Transcript: ENSMUST00000003714
SMART Domains Protein: ENSMUSP00000003714
Gene: ENSMUSG00000003617

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000012580
AA Change: Y991C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000012580
Gene: ENSMUSG00000027615
AA Change: Y991C

DomainStartEndE-ValueType
Pfam:HPS3_N 3 212 2.8e-74 PFAM
Pfam:HPS3_Mid 255 640 1.3e-167 PFAM
Pfam:HPS3_C 649 1000 1.8e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091309
SMART Domains Protein: ENSMUSP00000088857
Gene: ENSMUSG00000003617

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 7.7e-8 PFAM
Pfam:Cu-oxidase 220 357 1.1e-11 PFAM
Pfam:Cu-oxidase_2 280 357 2e-7 PFAM
Pfam:Cu-oxidase_3 444 557 4.6e-7 PFAM
Blast:FA58C 599 674 2e-6 BLAST
Pfam:Cu-oxidase_3 790 898 3.4e-9 PFAM
Pfam:Cu-oxidase_2 928 1055 1.6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108321
AA Change: Y859C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103957
Gene: ENSMUSG00000027615
AA Change: Y859C

DomainStartEndE-ValueType
Pfam:HPS3_N 3 87 5.6e-25 PFAM
Pfam:HPS3_Mid 121 508 4.2e-161 PFAM
Pfam:HPS3_C 517 870 9.2e-199 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108325
SMART Domains Protein: ENSMUSP00000103961
Gene: ENSMUSG00000003617

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 4.9e-8 PFAM
Pfam:Cu-oxidase 220 357 9.3e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 2e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.2e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108328
SMART Domains Protein: ENSMUSP00000103964
Gene: ENSMUSG00000003617

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108329
SMART Domains Protein: ENSMUSP00000103965
Gene: ENSMUSG00000003617

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 89 203 8.7e-8 PFAM
Pfam:Cu-oxidase 220 357 7.8e-12 PFAM
Pfam:Cu-oxidase_2 242 356 2.1e-7 PFAM
Pfam:Cu-oxidase_3 445 555 4.4e-7 PFAM
Blast:FA58C 599 674 3e-6 BLAST
Pfam:Cu-oxidase_3 793 898 6.1e-9 PFAM
Pfam:Cu-oxidase_2 931 1055 5.2e-18 PFAM
low complexity region 1068 1079 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141308
Predicted Effect probably benign
Transcript: ENSMUST00000172860
SMART Domains Protein: ENSMUSP00000133374
Gene: ENSMUSG00000003617

DomainStartEndE-ValueType
Pfam:Cu-oxidase 53 192 1.4e-6 PFAM
Pfam:Cu-oxidase_2 66 192 4.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173779
SMART Domains Protein: ENSMUSP00000133643
Gene: ENSMUSG00000003617

DomainStartEndE-ValueType
SCOP:d1gw0a3 1 37 7e-5 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a potential clathrin-binding motif, consensus dileucine signals, and tyrosine-based sorting signals for targeting to vesicles of lysosomal lineage. The encoded protein may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 3. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for spontaneous null mutations exhibit hypopigmentation and prolonged bleeding associated with a platelet defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,182,789 N6049S probably damaging Het
Aph1a C T 3: 95,894,261 R31W probably damaging Het
Atp10b T C 11: 43,172,754 V172A probably damaging Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Best3 T A 10: 116,988,674 F15Y possibly damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Crb1 A C 1: 139,337,473 L69R possibly damaging Het
Crcp T C 5: 130,034,950 probably null Het
Dysf G A 6: 84,186,509 probably null Het
Gm5724 A G 6: 141,727,714 I366T probably damaging Het
Irx5 C A 8: 92,359,686 N132K probably damaging Het
Itgb2 A G 10: 77,558,033 T436A probably benign Het
Kit A G 5: 75,609,318 D130G probably benign Het
Krt12 A G 11: 99,422,096 S41P unknown Het
Lypd6b G T 2: 49,943,540 S64I probably damaging Het
Mpc1 T A 17: 8,288,588 probably null Het
Olfr1214 T A 2: 88,988,111 L30F probably benign Het
Olfr1443 A T 19: 12,680,404 M99L probably benign Het
Pard3b T A 1: 62,159,452 I233N probably damaging Het
Pcdh1 A G 18: 38,199,458 V164A probably benign Het
Pclo A G 5: 14,679,918 probably benign Het
Pkhd1l1 T C 15: 44,592,026 probably null Het
Spata31d1d T C 13: 59,727,462 Q753R probably benign Het
Stxbp6 A G 12: 44,902,858 probably null Het
Trav6-5 T C 14: 53,491,381 S32P probably benign Het
Zp3r A C 1: 130,577,054 D470E possibly damaging Het
Other mutations in Hps3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Hps3 APN 3 20019807 missense possibly damaging 0.94
IGL00846:Hps3 APN 3 20025792 missense probably benign 0.00
IGL01320:Hps3 APN 3 20030469 missense probably benign 0.12
IGL01364:Hps3 APN 3 20003305 missense possibly damaging 0.58
IGL01751:Hps3 APN 3 20010966 missense probably damaging 1.00
IGL01843:Hps3 APN 3 20029001 missense probably benign 0.05
IGL02294:Hps3 APN 3 20014048 missense probably damaging 1.00
IGL02581:Hps3 APN 3 20003221 intron probably benign
Blue UTSW 3 20030796 missense probably damaging 1.00
earl_grey UTSW 3 20017173 intron probably benign
gandalf UTSW 3 20012796 nonsense probably null
pam_gray UTSW 3 20017173 intron probably benign
R0107:Hps3 UTSW 3 20030796 missense probably damaging 1.00
R0245:Hps3 UTSW 3 20012796 nonsense probably null
R0421:Hps3 UTSW 3 20029316 missense probably benign 0.00
R0524:Hps3 UTSW 3 20012776 missense probably damaging 1.00
R0763:Hps3 UTSW 3 20003279 missense probably damaging 1.00
R1795:Hps3 UTSW 3 20012695 critical splice donor site probably null
R1864:Hps3 UTSW 3 20019959 critical splice acceptor site probably null
R2029:Hps3 UTSW 3 20030527 missense probably benign 0.01
R2101:Hps3 UTSW 3 20012783 missense possibly damaging 0.95
R2221:Hps3 UTSW 3 20002363 missense probably benign
R2268:Hps3 UTSW 3 20012935 splice site probably benign
R2520:Hps3 UTSW 3 20029030 missense probably damaging 1.00
R3809:Hps3 UTSW 3 20018812 missense probably damaging 1.00
R3888:Hps3 UTSW 3 20003223 critical splice donor site probably null
R4022:Hps3 UTSW 3 20035261 missense possibly damaging 0.69
R4156:Hps3 UTSW 3 20029229 missense probably damaging 1.00
R4739:Hps3 UTSW 3 20030410 critical splice acceptor site probably null
R4823:Hps3 UTSW 3 20012726 missense probably benign 0.03
R4912:Hps3 UTSW 3 20014173 missense probably damaging 1.00
R5307:Hps3 UTSW 3 20012701 missense possibly damaging 0.89
R5859:Hps3 UTSW 3 20008870 missense probably benign 0.02
R6140:Hps3 UTSW 3 19996987 missense probably damaging 1.00
R6183:Hps3 UTSW 3 20008868 missense probably benign 0.04
R6971:Hps3 UTSW 3 20011535 missense probably damaging 1.00
R6981:Hps3 UTSW 3 20022820 missense probably damaging 1.00
R7120:Hps3 UTSW 3 20011541 missense probably damaging 1.00
R7146:Hps3 UTSW 3 20008886 missense probably damaging 1.00
R7223:Hps3 UTSW 3 20030419 missense probably benign 0.05
R7448:Hps3 UTSW 3 20035165 missense probably damaging 0.99
R7452:Hps3 UTSW 3 20011428 missense probably damaging 1.00
R7560:Hps3 UTSW 3 20030452 missense probably benign 0.29
R7659:Hps3 UTSW 3 20022814 nonsense probably null
R7769:Hps3 UTSW 3 20018808 splice site probably null
R8050:Hps3 UTSW 3 20003328 missense probably benign
R8242:Hps3 UTSW 3 20014126 missense possibly damaging 0.59
X0021:Hps3 UTSW 3 20030749 missense probably benign 0.14
X0066:Hps3 UTSW 3 20015988 missense probably damaging 1.00
Z1177:Hps3 UTSW 3 20008901 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACAATTACAGGGTAAGGTAAGC -3'
(R):5'- TAACTCAAATTCCAGGGGCTAAAC -3'

Sequencing Primer
(F):5'- GGTAAGCACCCTTAAAGCAGC -3'
(R):5'- ATTGTAGGGCATTTGAAGG -3'
Posted On2015-04-30