Incidental Mutation 'R3942:Crcp'
ID312899
Institutional Source Beutler Lab
Gene Symbol Crcp
Ensembl Gene ENSMUSG00000025532
Gene Namecalcitonin gene-related peptide-receptor component protein
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.880) question?
Stock #R3942 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location130029290-130060789 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 130034950 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026608] [ENSMUST00000202163] [ENSMUST00000202756]
Predicted Effect probably null
Transcript: ENSMUST00000026608
SMART Domains Protein: ENSMUSP00000026608
Gene: ENSMUSG00000025532

DomainStartEndE-ValueType
RPOL4c 1 127 9.32e-62 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201777
Predicted Effect probably null
Transcript: ENSMUST00000202163
SMART Domains Protein: ENSMUSP00000144624
Gene: ENSMUSG00000025532

DomainStartEndE-ValueType
Blast:RPOL4c 1 47 2e-26 BLAST
low complexity region 48 59 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202756
SMART Domains Protein: ENSMUSP00000143969
Gene: ENSMUSG00000025532

DomainStartEndE-ValueType
RPOL4c 1 76 6.5e-8 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein that functions as part of a receptor complex for a small neuropeptide that increases intracellular cAMP levels. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,182,789 N6049S probably damaging Het
Aph1a C T 3: 95,894,261 R31W probably damaging Het
Atp10b T C 11: 43,172,754 V172A probably damaging Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Best3 T A 10: 116,988,674 F15Y possibly damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Crb1 A C 1: 139,337,473 L69R possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Gm5724 A G 6: 141,727,714 I366T probably damaging Het
Hps3 T C 3: 19,996,939 Y859C probably damaging Het
Irx5 C A 8: 92,359,686 N132K probably damaging Het
Itgb2 A G 10: 77,558,033 T436A probably benign Het
Kit A G 5: 75,609,318 D130G probably benign Het
Krt12 A G 11: 99,422,096 S41P unknown Het
Lypd6b G T 2: 49,943,540 S64I probably damaging Het
Mpc1 T A 17: 8,288,588 probably null Het
Olfr1214 T A 2: 88,988,111 L30F probably benign Het
Olfr1443 A T 19: 12,680,404 M99L probably benign Het
Pard3b T A 1: 62,159,452 I233N probably damaging Het
Pcdh1 A G 18: 38,199,458 V164A probably benign Het
Pclo A G 5: 14,679,918 probably benign Het
Pkhd1l1 T C 15: 44,592,026 probably null Het
Spata31d1d T C 13: 59,727,462 Q753R probably benign Het
Stxbp6 A G 12: 44,902,858 probably null Het
Trav6-5 T C 14: 53,491,381 S32P probably benign Het
Zp3r A C 1: 130,577,054 D470E possibly damaging Het
Other mutations in Crcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02005:Crcp APN 5 130042233 missense probably benign 0.33
IGL02475:Crcp APN 5 130059858 utr 3 prime probably benign
R0329:Crcp UTSW 5 130042242 missense possibly damaging 0.50
R0899:Crcp UTSW 5 130059831 missense probably benign 0.00
R4828:Crcp UTSW 5 130059762 missense probably damaging 1.00
R6168:Crcp UTSW 5 130037896 missense probably damaging 1.00
R7887:Crcp UTSW 5 130037870 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCTGAAATTGCTAACCAGGGC -3'
(R):5'- GAGACTCTGGGATTTTCGGCAG -3'

Sequencing Primer
(F):5'- CCAGGGCAGAACTTAAGGCATTTC -3'
(R):5'- TCGGCAGAGTACCTATTGTGAACC -3'
Posted On2015-04-30