Incidental Mutation 'R3942:Best3'
ID312905
Institutional Source Beutler Lab
Gene Symbol Best3
Ensembl Gene ENSMUSG00000020169
Gene Namebestrophin 3
SynonymsmBest4, Vmd2l3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R3942 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location116986314-117025040 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116988674 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 15 (F15Y)
Ref Sequence ENSEMBL: ENSMUSP00000020378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020378]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020378
AA Change: F15Y

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020378
Gene: ENSMUSG00000020169
AA Change: F15Y

DomainStartEndE-ValueType
Pfam:Bestrophin 8 316 7.3e-115 PFAM
low complexity region 405 416 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BEST3 belongs to the bestrophin family of anion channels, which includes BEST1 (MIM 607854), the gene mutant in vitelliform macular dystrophy (VMD; MIM 153700), and 2 other BEST1-like genes, BEST2 (MIM 607335) and BEST4 (MIM 607336). Bestrophins are transmembrane (TM) proteins that share a homology region containing a high content of aromatic residues, including an invariant arg-phe-pro (RFP) motif. The bestrophin genes share a conserved gene structure, with almost identical sizes of the 8 RFP-TM domain-encoding exons and highly conserved exon-intron boundaries. Each of the 4 bestrophin genes has a unique 3-prime end of variable length (Stohr et al., 2002 [PubMed 12032738]; Tsunenari et al., 2003 [PubMed 12907679]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,182,789 N6049S probably damaging Het
Aph1a C T 3: 95,894,261 R31W probably damaging Het
Atp10b T C 11: 43,172,754 V172A probably damaging Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Crb1 A C 1: 139,337,473 L69R possibly damaging Het
Crcp T C 5: 130,034,950 probably null Het
Dysf G A 6: 84,186,509 probably null Het
Gm5724 A G 6: 141,727,714 I366T probably damaging Het
Hps3 T C 3: 19,996,939 Y859C probably damaging Het
Irx5 C A 8: 92,359,686 N132K probably damaging Het
Itgb2 A G 10: 77,558,033 T436A probably benign Het
Kit A G 5: 75,609,318 D130G probably benign Het
Krt12 A G 11: 99,422,096 S41P unknown Het
Lypd6b G T 2: 49,943,540 S64I probably damaging Het
Mpc1 T A 17: 8,288,588 probably null Het
Olfr1214 T A 2: 88,988,111 L30F probably benign Het
Olfr1443 A T 19: 12,680,404 M99L probably benign Het
Pard3b T A 1: 62,159,452 I233N probably damaging Het
Pcdh1 A G 18: 38,199,458 V164A probably benign Het
Pclo A G 5: 14,679,918 probably benign Het
Pkhd1l1 T C 15: 44,592,026 probably null Het
Spata31d1d T C 13: 59,727,462 Q753R probably benign Het
Stxbp6 A G 12: 44,902,858 probably null Het
Trav6-5 T C 14: 53,491,381 S32P probably benign Het
Zp3r A C 1: 130,577,054 D470E possibly damaging Het
Other mutations in Best3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Best3 APN 10 116988727 missense probably damaging 1.00
IGL00158:Best3 APN 10 117004541 splice site probably benign
IGL02493:Best3 APN 10 117024601 missense possibly damaging 0.95
IGL02713:Best3 APN 10 117024529 missense probably benign 0.00
IGL03178:Best3 APN 10 116988779 missense probably damaging 1.00
IGL03355:Best3 APN 10 116993105 missense possibly damaging 0.82
R0531:Best3 UTSW 10 117004375 splice site probably benign
R0578:Best3 UTSW 10 117008999 missense probably benign 0.06
R1671:Best3 UTSW 10 117024668 missense possibly damaging 0.58
R1769:Best3 UTSW 10 117023978 missense probably benign 0.00
R1860:Best3 UTSW 10 116993273 missense probably damaging 1.00
R1935:Best3 UTSW 10 117024386 missense probably benign
R2103:Best3 UTSW 10 117002594 missense probably benign 0.01
R4260:Best3 UTSW 10 117024226 missense probably benign
R4332:Best3 UTSW 10 117002524 missense probably benign 0.37
R4741:Best3 UTSW 10 117023996 missense probably benign 0.06
R4760:Best3 UTSW 10 117024794 missense probably benign 0.00
R4896:Best3 UTSW 10 117024555 missense probably benign 0.00
R4912:Best3 UTSW 10 117008981 missense probably damaging 1.00
R5023:Best3 UTSW 10 116988742 missense probably benign 0.06
R5087:Best3 UTSW 10 117009002 missense probably benign 0.01
R5213:Best3 UTSW 10 117024472 missense probably benign 0.01
R5457:Best3 UTSW 10 117004511 missense probably damaging 1.00
R5928:Best3 UTSW 10 117007627 missense probably damaging 1.00
R5982:Best3 UTSW 10 117004417 missense probably damaging 0.98
R6335:Best3 UTSW 10 117002651 missense probably benign 0.32
R7068:Best3 UTSW 10 116988638 missense probably damaging 1.00
R7469:Best3 UTSW 10 117004385 missense probably damaging 1.00
R8139:Best3 UTSW 10 117004426 missense probably damaging 1.00
R8306:Best3 UTSW 10 117002610 missense probably damaging 1.00
R8715:Best3 UTSW 10 116993066 missense probably damaging 1.00
R8847:Best3 UTSW 10 116988667 missense possibly damaging 0.83
RF014:Best3 UTSW 10 117004505 missense probably damaging 1.00
Z1088:Best3 UTSW 10 117024170 missense probably benign 0.00
Z1176:Best3 UTSW 10 117024622 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- CTATGAGAGGAGTGCGTGATGC -3'
(R):5'- GTTACATAATGCAGAGGCTAGCG -3'

Sequencing Primer
(F):5'- CATGGAGGGTGGGTCAGC -3'
(R):5'- CAACCAAGGGGATCCAGTTTTTG -3'
Posted On2015-04-30