Incidental Mutation 'R3942:Krt12'
ID312907
Institutional Source Beutler Lab
Gene Symbol Krt12
Ensembl Gene ENSMUSG00000020912
Gene Namekeratin 12
SynonymsK12, Krt1-12
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R3942 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location99415666-99422259 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99422096 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 41 (S41P)
Ref Sequence ENSEMBL: ENSMUSP00000017741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017741]
Predicted Effect unknown
Transcript: ENSMUST00000017741
AA Change: S41P
SMART Domains Protein: ENSMUSP00000017741
Gene: ENSMUSG00000020912
AA Change: S41P

DomainStartEndE-ValueType
low complexity region 26 69 N/A INTRINSIC
low complexity region 73 104 N/A INTRINSIC
Filament 118 432 1.87e-153 SMART
low complexity region 474 486 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139095
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] KRT12 encodes the type I intermediate filament chain keratin 12, expressed in corneal epithelia. Mutations in this gene lead to Meesmann corneal dystrophy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants display abnormal and fragile corneal epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,182,789 N6049S probably damaging Het
Aph1a C T 3: 95,894,261 R31W probably damaging Het
Atp10b T C 11: 43,172,754 V172A probably damaging Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Best3 T A 10: 116,988,674 F15Y possibly damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Crb1 A C 1: 139,337,473 L69R possibly damaging Het
Crcp T C 5: 130,034,950 probably null Het
Dysf G A 6: 84,186,509 probably null Het
Gm5724 A G 6: 141,727,714 I366T probably damaging Het
Hps3 T C 3: 19,996,939 Y859C probably damaging Het
Irx5 C A 8: 92,359,686 N132K probably damaging Het
Itgb2 A G 10: 77,558,033 T436A probably benign Het
Kit A G 5: 75,609,318 D130G probably benign Het
Lypd6b G T 2: 49,943,540 S64I probably damaging Het
Mpc1 T A 17: 8,288,588 probably null Het
Olfr1214 T A 2: 88,988,111 L30F probably benign Het
Olfr1443 A T 19: 12,680,404 M99L probably benign Het
Pard3b T A 1: 62,159,452 I233N probably damaging Het
Pcdh1 A G 18: 38,199,458 V164A probably benign Het
Pclo A G 5: 14,679,918 probably benign Het
Pkhd1l1 T C 15: 44,592,026 probably null Het
Spata31d1d T C 13: 59,727,462 Q753R probably benign Het
Stxbp6 A G 12: 44,902,858 probably null Het
Trav6-5 T C 14: 53,491,381 S32P probably benign Het
Zp3r A C 1: 130,577,054 D470E possibly damaging Het
Other mutations in Krt12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02968:Krt12 APN 11 99418017 missense probably damaging 0.98
R0348:Krt12 UTSW 11 99417945 missense probably damaging 1.00
R1104:Krt12 UTSW 11 99421966 missense unknown
R1662:Krt12 UTSW 11 99420824 missense probably benign 0.42
R1763:Krt12 UTSW 11 99416060 missense probably damaging 1.00
R1886:Krt12 UTSW 11 99418576 missense probably damaging 1.00
R2087:Krt12 UTSW 11 99418633 missense probably damaging 0.98
R3859:Krt12 UTSW 11 99418493 missense possibly damaging 0.90
R4030:Krt12 UTSW 11 99422028 missense unknown
R4061:Krt12 UTSW 11 99416015 missense unknown
R4672:Krt12 UTSW 11 99418683 intron probably benign
R4867:Krt12 UTSW 11 99416963 missense possibly damaging 0.90
R4907:Krt12 UTSW 11 99418362 missense probably damaging 1.00
R5592:Krt12 UTSW 11 99420824 missense probably benign 0.00
R6276:Krt12 UTSW 11 99421902 nonsense probably null
R6326:Krt12 UTSW 11 99416919 missense probably benign
R7108:Krt12 UTSW 11 99416052 missense unknown
R7144:Krt12 UTSW 11 99416013 makesense probably null
R7524:Krt12 UTSW 11 99419659 missense probably damaging 1.00
R7769:Krt12 UTSW 11 99418026 missense probably damaging 1.00
R7813:Krt12 UTSW 11 99418483 critical splice donor site probably null
X0026:Krt12 UTSW 11 99419584 missense probably damaging 1.00
Z1176:Krt12 UTSW 11 99420761 nonsense probably null
Z1177:Krt12 UTSW 11 99422104 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGACCTCCATCATTGCCAG -3'
(R):5'- TATAAAGGCAGGACCCCTTCTG -3'

Sequencing Primer
(F):5'- TCATTGCCAGAAAAGATACACAGAG -3'
(R):5'- AGGACCCCTTCTGGCATAC -3'
Posted On2015-04-30