Incidental Mutation 'R3942:Stxbp6'
ID312908
Institutional Source Beutler Lab
Gene Symbol Stxbp6
Ensembl Gene ENSMUSG00000046314
Gene Namesyntaxin binding protein 6 (amisyn)
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R3942 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location44852484-45074709 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 44902858 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053768] [ENSMUST00000120531] [ENSMUST00000143376]
Predicted Effect probably null
Transcript: ENSMUST00000053768
SMART Domains Protein: ENSMUSP00000052639
Gene: ENSMUSG00000046314

DomainStartEndE-ValueType
Sec3-PIP2_bind 41 133 1.79e-36 SMART
Pfam:Synaptobrevin 153 210 2e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120531
SMART Domains Protein: ENSMUSP00000112551
Gene: ENSMUSG00000046314

DomainStartEndE-ValueType
Sec3-PIP2_bind 41 133 1.79e-36 SMART
Pfam:Synaptobrevin 153 210 2.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130202
Predicted Effect probably benign
Transcript: ENSMUST00000143376
SMART Domains Protein: ENSMUSP00000117366
Gene: ENSMUSG00000046314

DomainStartEndE-ValueType
Pfam:Sec3-PIP2_bind 41 89 3.8e-14 PFAM
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] STXBP6 binds components of the SNARE complex (see MIM 603215) and may be involved in regulating SNARE complex formation (Scales et al., 2002 [PubMed 12145319]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,182,789 N6049S probably damaging Het
Aph1a C T 3: 95,894,261 R31W probably damaging Het
Atp10b T C 11: 43,172,754 V172A probably damaging Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Best3 T A 10: 116,988,674 F15Y possibly damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Crb1 A C 1: 139,337,473 L69R possibly damaging Het
Crcp T C 5: 130,034,950 probably null Het
Dysf G A 6: 84,186,509 probably null Het
Gm5724 A G 6: 141,727,714 I366T probably damaging Het
Hps3 T C 3: 19,996,939 Y859C probably damaging Het
Irx5 C A 8: 92,359,686 N132K probably damaging Het
Itgb2 A G 10: 77,558,033 T436A probably benign Het
Kit A G 5: 75,609,318 D130G probably benign Het
Krt12 A G 11: 99,422,096 S41P unknown Het
Lypd6b G T 2: 49,943,540 S64I probably damaging Het
Mpc1 T A 17: 8,288,588 probably null Het
Olfr1214 T A 2: 88,988,111 L30F probably benign Het
Olfr1443 A T 19: 12,680,404 M99L probably benign Het
Pard3b T A 1: 62,159,452 I233N probably damaging Het
Pcdh1 A G 18: 38,199,458 V164A probably benign Het
Pclo A G 5: 14,679,918 probably benign Het
Pkhd1l1 T C 15: 44,592,026 probably null Het
Spata31d1d T C 13: 59,727,462 Q753R probably benign Het
Trav6-5 T C 14: 53,491,381 S32P probably benign Het
Zp3r A C 1: 130,577,054 D470E possibly damaging Het
Other mutations in Stxbp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Stxbp6 APN 12 44861346 missense probably damaging 0.97
IGL02067:Stxbp6 APN 12 44861298 missense probably damaging 1.00
IGL02120:Stxbp6 APN 12 44902048 unclassified probably benign
IGL02186:Stxbp6 APN 12 44902023 missense probably damaging 1.00
R0417:Stxbp6 UTSW 12 44902957 missense probably damaging 1.00
R1772:Stxbp6 UTSW 12 44902870 missense probably damaging 0.97
R1990:Stxbp6 UTSW 12 44855857 nonsense probably null
R3939:Stxbp6 UTSW 12 44902858 critical splice donor site probably null
R6614:Stxbp6 UTSW 12 44861275 missense probably benign 0.11
R6787:Stxbp6 UTSW 12 44902996 splice site probably null
R7162:Stxbp6 UTSW 12 44902880 missense probably benign 0.13
R7264:Stxbp6 UTSW 12 44901999 missense probably damaging 1.00
R7275:Stxbp6 UTSW 12 44902003 missense probably benign 0.00
R7694:Stxbp6 UTSW 12 44902027 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGAGACAGCATCTTTCCATATG -3'
(R):5'- CAATGTACCTCCCCATTAATCTGAG -3'

Sequencing Primer
(F):5'- TCTCTTGGATTTCTCTATCAAACATG -3'
(R):5'- TCCACATCATTCGTCCGA -3'
Posted On2015-04-30