Incidental Mutation 'R3942:Mpc1'
ID312913
Institutional Source Beutler Lab
Gene Symbol Mpc1
Ensembl Gene ENSMUSG00000023861
Gene Namemitochondrial pyruvate carrier 1
SynonymsBrp44l, 3830411I18Rik, 0610006G08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R3942 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location8282904-8297661 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 8288588 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046754] [ENSMUST00000124023] [ENSMUST00000142594] [ENSMUST00000142594] [ENSMUST00000145402] [ENSMUST00000155364]
Predicted Effect probably benign
Transcript: ENSMUST00000046754
SMART Domains Protein: ENSMUSP00000045654
Gene: ENSMUSG00000023861

DomainStartEndE-ValueType
Pfam:MPC 7 108 2.4e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124023
SMART Domains Protein: ENSMUSP00000118386
Gene: ENSMUSG00000023861

DomainStartEndE-ValueType
Pfam:MPC 1 85 5.5e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130639
Predicted Effect probably null
Transcript: ENSMUST00000142594
SMART Domains Protein: ENSMUSP00000119901
Gene: ENSMUSG00000023861

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:MPC 70 167 1.1e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000142594
SMART Domains Protein: ENSMUSP00000119901
Gene: ENSMUSG00000023861

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:MPC 70 167 1.1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145402
SMART Domains Protein: ENSMUSP00000122214
Gene: ENSMUSG00000023861

DomainStartEndE-ValueType
Pfam:MPC 7 78 5.4e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147427
Predicted Effect probably benign
Transcript: ENSMUST00000155364
SMART Domains Protein: ENSMUSP00000119443
Gene: ENSMUSG00000023861

DomainStartEndE-ValueType
Pfam:MPC 7 108 2.4e-40 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of an MPC1/MPC2 heterodimer that is responsible for transporting pyruvate into mitochondria. The encoded protein is found in the inner mitochondrial membrane. Defects in this gene are a cause of mitochondrial pyruvate carrier deficiency. Several transcript variants, some protein coding and one non-protein coding, have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a conditional allele activated in the liver exhibit altered gluconeogenesis and whole body glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,182,789 N6049S probably damaging Het
Aph1a C T 3: 95,894,261 R31W probably damaging Het
Atp10b T C 11: 43,172,754 V172A probably damaging Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Best3 T A 10: 116,988,674 F15Y possibly damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Crb1 A C 1: 139,337,473 L69R possibly damaging Het
Crcp T C 5: 130,034,950 probably null Het
Dysf G A 6: 84,186,509 probably null Het
Gm5724 A G 6: 141,727,714 I366T probably damaging Het
Hps3 T C 3: 19,996,939 Y859C probably damaging Het
Irx5 C A 8: 92,359,686 N132K probably damaging Het
Itgb2 A G 10: 77,558,033 T436A probably benign Het
Kit A G 5: 75,609,318 D130G probably benign Het
Krt12 A G 11: 99,422,096 S41P unknown Het
Lypd6b G T 2: 49,943,540 S64I probably damaging Het
Olfr1214 T A 2: 88,988,111 L30F probably benign Het
Olfr1443 A T 19: 12,680,404 M99L probably benign Het
Pard3b T A 1: 62,159,452 I233N probably damaging Het
Pcdh1 A G 18: 38,199,458 V164A probably benign Het
Pclo A G 5: 14,679,918 probably benign Het
Pkhd1l1 T C 15: 44,592,026 probably null Het
Spata31d1d T C 13: 59,727,462 Q753R probably benign Het
Stxbp6 A G 12: 44,902,858 probably null Het
Trav6-5 T C 14: 53,491,381 S32P probably benign Het
Zp3r A C 1: 130,577,054 D470E possibly damaging Het
Other mutations in Mpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02687:Mpc1 APN 17 8297143 missense probably benign 0.14
R1897:Mpc1 UTSW 17 8296878 missense possibly damaging 0.82
R4770:Mpc1 UTSW 17 8293545 intron probably benign
R5188:Mpc1 UTSW 17 8296383 intron probably benign
R6484:Mpc1 UTSW 17 8296956 missense possibly damaging 0.90
R7852:Mpc1 UTSW 17 8296908 missense probably damaging 0.99
R8090:Mpc1 UTSW 17 8296873 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GGTCTGAAGACAGCTACAGTG -3'
(R):5'- GGTGAATGCTAACCTTTTATCCTGC -3'

Sequencing Primer
(F):5'- CTGAAGACAGCTACAGTGTACTTAC -3'
(R):5'- AGACAAAGTCTCCTCTTGTAGC -3'
Posted On2015-04-30