Incidental Mutation 'R3942:Olfr1443'
ID312915
Institutional Source Beutler Lab
Gene Symbol Olfr1443
Ensembl Gene ENSMUSG00000045030
Gene Nameolfactory receptor 1443
SynonymsMOR202-8, GA_x6K02T2RE5P-3006492-3007430
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R3942 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12678112-12683851 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12680404 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 99 (M99L)
Ref Sequence ENSEMBL: ENSMUSP00000150063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049724] [ENSMUST00000207341] [ENSMUST00000208494] [ENSMUST00000208657] [ENSMUST00000213486] [ENSMUST00000215134]
Predicted Effect probably benign
Transcript: ENSMUST00000049724
AA Change: M99L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000059886
Gene: ENSMUSG00000045030
AA Change: M99L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.4e-50 PFAM
Pfam:7TM_GPCR_Srsx 33 303 1.5e-6 PFAM
Pfam:7tm_1 39 288 8.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208407
Predicted Effect probably benign
Transcript: ENSMUST00000208494
Predicted Effect probably benign
Transcript: ENSMUST00000208657
Predicted Effect probably benign
Transcript: ENSMUST00000213486
AA Change: M99L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000215134
AA Change: M99L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T C 13: 81,182,789 N6049S probably damaging Het
Aph1a C T 3: 95,894,261 R31W probably damaging Het
Atp10b T C 11: 43,172,754 V172A probably damaging Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Best3 T A 10: 116,988,674 F15Y possibly damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Crb1 A C 1: 139,337,473 L69R possibly damaging Het
Crcp T C 5: 130,034,950 probably null Het
Dysf G A 6: 84,186,509 probably null Het
Gm5724 A G 6: 141,727,714 I366T probably damaging Het
Hps3 T C 3: 19,996,939 Y859C probably damaging Het
Irx5 C A 8: 92,359,686 N132K probably damaging Het
Itgb2 A G 10: 77,558,033 T436A probably benign Het
Kit A G 5: 75,609,318 D130G probably benign Het
Krt12 A G 11: 99,422,096 S41P unknown Het
Lypd6b G T 2: 49,943,540 S64I probably damaging Het
Mpc1 T A 17: 8,288,588 probably null Het
Olfr1214 T A 2: 88,988,111 L30F probably benign Het
Pard3b T A 1: 62,159,452 I233N probably damaging Het
Pcdh1 A G 18: 38,199,458 V164A probably benign Het
Pclo A G 5: 14,679,918 probably benign Het
Pkhd1l1 T C 15: 44,592,026 probably null Het
Spata31d1d T C 13: 59,727,462 Q753R probably benign Het
Stxbp6 A G 12: 44,902,858 probably null Het
Trav6-5 T C 14: 53,491,381 S32P probably benign Het
Zp3r A C 1: 130,577,054 D470E possibly damaging Het
Other mutations in Olfr1443
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Olfr1443 APN 19 12680749 missense probably benign 0.02
IGL01392:Olfr1443 APN 19 12680803 missense probably benign 0.42
IGL01470:Olfr1443 APN 19 12680671 missense possibly damaging 0.91
IGL03106:Olfr1443 APN 19 12680923 missense possibly damaging 0.61
R2036:Olfr1443 UTSW 19 12680801 missense probably damaging 1.00
R5459:Olfr1443 UTSW 19 12680435 missense probably damaging 1.00
R5643:Olfr1443 UTSW 19 12680972 missense probably damaging 1.00
R5644:Olfr1443 UTSW 19 12680972 missense probably damaging 1.00
R6879:Olfr1443 UTSW 19 12680771 missense probably benign 0.18
R6991:Olfr1443 UTSW 19 12680748 missense probably benign 0.14
R7084:Olfr1443 UTSW 19 12680834 missense probably damaging 0.98
R7352:Olfr1443 UTSW 19 12680751 missense possibly damaging 0.78
R7749:Olfr1443 UTSW 19 12680212 missense probably benign 0.10
R8133:Olfr1443 UTSW 19 12680480 missense probably damaging 1.00
R8163:Olfr1443 UTSW 19 12680188 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAACTTGGGGATGCTTGTGC -3'
(R):5'- TGATGGACCACATTGGACTTG -3'

Sequencing Primer
(F):5'- GCTGATTCTCTGGGACTCTCGAC -3'
(R):5'- AAGTAGAGTCTGAATGTGTCCCC -3'
Posted On2015-04-30