Mutagenetix > Incidental Mutation

Incidental Mutation 'R3973:Copa'

312917

Institutional Source

Beutler Lab

Gene Symbol

Copa

Ensembl Gene

ENSMUSG00000026553

Gene Name

coatomer protein complex subunit alpha

Synonyms

xenin

MMRRC Submission

040841-MU

Accession Numbers

Genbank: NM_009938; MGI: 1334462

Essential gene?

Probably essential (E-score: 0.971) question?

Stock #

R3973 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

172082529-172122330 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 172121245 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1155 (S1155T)

Ref Sequence

ENSEMBL: ENSMUSP00000027833 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027833] [ENSMUST00000135192]

AlphaFold

Q8CIE6

Predicted Effect

probably benign
Transcript: ENSMUST00000027833
AA Change: S1155T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000027833
Gene: ENSMUSG00000026553
AA Change: S1155T

Domain	Start	End	E-Value	Type
WD40	2	37	2.86e0	SMART
WD40	40	79	1.11e-6	SMART
WD40	82	121	4.76e-6	SMART
WD40	124	163	2.24e-11	SMART
WD40	194	233	2.98e-7	SMART
WD40	238	277	8.42e-7	SMART
WD40	280	318	1.38e1	SMART
Pfam:Coatomer_WDAD	338	776	5.4e-144	PFAM
Pfam:COPI_C	824	1233	1.4e-190	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122845

Predicted Effect

probably benign
Transcript: ENSMUST00000135192
AA Change: S1146T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000118179
Gene: ENSMUSG00000026553
AA Change: S1146T

Domain	Start	End	E-Value	Type
WD40	2	37	2.86e0	SMART
WD40	40	79	1.11e-6	SMART
WD40	82	121	4.76e-6	SMART
WD40	124	163	2.24e-11	SMART
WD40	194	233	2.98e-7	SMART
WD40	238	277	8.42e-7	SMART
WD40	280	318	1.38e1	SMART
Pfam:Coatomer_WDAD	338	767	1.1e-148	PFAM
Pfam:COPI_C	815	1224	3.6e-216	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142765

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.3%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In eukaryotic cells, protein transport between the endoplasmic reticulum and Golgi compartments is mediated in part by non-clathrin-coated vesicular coat proteins (COPs). Seven coat proteins have been identified, and they represent subunits of a complex known as coatomer. The subunits are designated alpha-COP, beta-COP, beta-prime-COP, gamma-COP, delta-COP, epsilon-COP, and zeta-COP. The alpha-COP, encoded by COPA, shares high sequence similarity with RET1P, the alpha subunit of the coatomer complex in yeast. Also, the N-terminal 25 amino acids of alpha-COP encode the bioactive peptide, xenin, which stimulates exocrine pancreatic secretion and may act as a gastrointestinal hormone. Alternative splicing results in multiple splice forms encoding distinct isoforms. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	T	C	4: 147,945,031	I486T	probably damaging	Het
4921501E09Rik	A	T	17: 33,066,431	S466T	probably benign	Het
4933427D14Rik	T	C	11: 72,198,741	R106G	probably damaging	Het
Cfap54	A	G	10: 92,839,471	S2863P	possibly damaging	Het
Crot	T	C	5: 8,977,541	T264A	probably benign	Het
Ddx3y	G	A	Y: 1,267,170	A232V	probably damaging	Het
Dst	T	G	1: 34,011,898	V25G	probably benign	Het
Ehbp1	C	T	11: 22,137,867	A406T	probably benign	Het
Eml5	A	T	12: 98,802,465		probably benign	Het
Eps8	A	T	6: 137,509,155	M453K	probably benign	Het
Galnt3	T	C	2: 66,107,030	D112G	possibly damaging	Het
Glra4	C	T	X: 136,762,793	A336T	probably damaging	Het
Gmppb	A	G	9: 108,050,139	D95G	probably benign	Het
Gprc6a	T	C	10: 51,628,448	Y100C	possibly damaging	Het
Gpx6	C	A	13: 21,317,658	S150Y	probably damaging	Het
Hsd17b3	A	T	13: 64,059,486	V247D	probably damaging	Het
Htr7	T	C	19: 36,056,760	D165G	probably damaging	Het
Igha	T	C	12: 113,256,352		probably benign	Het
Igsf10	A	G	3: 59,331,924	C279R	probably damaging	Het
Irak4	A	G	15: 94,554,740	E182G	possibly damaging	Het
Lipo3	A	T	19: 33,558,323	V274E	probably damaging	Het
Lrpprc	A	C	17: 84,770,841		probably null	Het
Mast1	T	C	8: 84,918,764	Y684C	probably damaging	Het
Mdn1	T	C	4: 32,722,363	F2382L	probably benign	Het
Mepe	C	T	5: 104,337,078	P28L	probably benign	Het
Mrgpra3	T	A	7: 47,589,666	I171F	probably benign	Het
Muc2	T	A	7: 141,746,804		probably benign	Het
Myh3	C	T	11: 67,096,436	Q1371*	probably null	Het
Nodal	T	A	10: 61,423,054	V90E	probably benign	Het
Npas4	A	T	19: 4,986,551	H528Q	probably benign	Het
Nt5dc3	T	C	10: 86,824,236	V382A	probably damaging	Het
Pcdh18	G	A	3: 49,754,586	T293I	probably damaging	Het
Phf20l1	A	G	15: 66,641,816	D947G	probably damaging	Het
Pla2r1	A	G	2: 60,448,962	V758A	probably benign	Het
Plod2	G	T	9: 92,598,619	G422*	probably null	Het
Ppp1r12a	T	C	10: 108,253,480	V660A	probably benign	Het
Prdm6	T	C	18: 53,540,206	I186T	possibly damaging	Het
Prkd3	G	A	17: 78,959,141		probably benign	Het
Prrc2a	A	G	17: 35,157,932	L734P	probably damaging	Het
Rnf128	C	A	X: 139,664,522	L282I	probably damaging	Het
Rnf213	A	G	11: 119,469,053	N4424S		Het
Scrn3	T	C	2: 73,335,777	S385P	possibly damaging	Het
Serpina1d	A	T	12: 103,767,848	S66T	probably benign	Het
Setd3	T	C	12: 108,165,158	K3R	possibly damaging	Het
Slc2a7	A	G	4: 150,158,210		probably null	Het
Smad4	G	T	18: 73,677,736	T59K	possibly damaging	Het
Spc25	A	G	2: 69,202,601	L60P	probably damaging	Het
Stam	A	C	2: 14,138,961	H354P	probably damaging	Het
Tesk1	C	T	4: 43,445,786	P280S	possibly damaging	Het
Tmem120a	C	G	5: 135,736,277	R254P	probably benign	Het
Traf5	T	C	1: 191,997,876	T405A	probably benign	Het
Trav7-4	A	G	14: 53,461,662	S89G	probably benign	Het
Tsc22d1	T	C	14: 76,418,609	S761P	probably damaging	Het
Ugt1a10	C	A	1: 88,216,140	H361N	probably damaging	Het
Ugt2b1	C	A	5: 86,917,675	V502L	probably benign	Het
Vip	T	A	10: 5,642,590	S77T	possibly damaging	Het
Wdr72	A	T	9: 74,218,697	M1025L	probably benign	Het
Zfp541	A	G	7: 16,072,222	D94G	probably damaging	Het

Other mutations in Copa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00848:Copa	APN	1	172110688	missense	possibly damaging	0.87
IGL01360:Copa	APN	1	172087588	splice site	probably null
IGL01434:Copa	APN	1	172119561	missense	probably benign	0.00
IGL01744:Copa	APN	1	172113189	missense	probably benign	0.01
IGL01837:Copa	APN	1	172118852	missense	probably benign	0.01
IGL01988:Copa	APN	1	172118264	missense	probably benign	0.09
IGL02059:Copa	APN	1	172099753	missense	probably damaging	0.96
IGL02123:Copa	APN	1	172112128	missense	probably damaging	1.00
IGL02731:Copa	APN	1	172102218	missense	possibly damaging	0.77
IGL03114:Copa	APN	1	172119268	nonsense	probably null
P0027:Copa	UTSW	1	172111948	missense	possibly damaging	0.87
PIT4434001:Copa	UTSW	1	172106175	missense	probably benign	0.00
R0233:Copa	UTSW	1	172087667	critical splice donor site	probably null
R0465:Copa	UTSW	1	172118305	missense	probably damaging	1.00
R0547:Copa	UTSW	1	172121687	splice site	probably benign
R0568:Copa	UTSW	1	172112137	missense	possibly damaging	0.91
R0628:Copa	UTSW	1	172091025	splice site	probably benign
R1328:Copa	UTSW	1	172121691	splice site	probably benign
R1494:Copa	UTSW	1	172104127	missense	probably benign	0.27
R1728:Copa	UTSW	1	172111987	missense	probably benign
R1758:Copa	UTSW	1	172104144	missense	probably damaging	1.00
R1784:Copa	UTSW	1	172111987	missense	probably benign
R1942:Copa	UTSW	1	172111888	missense	probably damaging	1.00
R2054:Copa	UTSW	1	172118957	nonsense	probably null
R2299:Copa	UTSW	1	172121725	missense	probably benign	0.10
R2518:Copa	UTSW	1	172119901	missense	probably benign
R2680:Copa	UTSW	1	172121404	nonsense	probably null
R3080:Copa	UTSW	1	172113149	missense	probably damaging	1.00
R3160:Copa	UTSW	1	172091233	missense	probably damaging	1.00
R3161:Copa	UTSW	1	172091233	missense	probably damaging	1.00
R3162:Copa	UTSW	1	172091233	missense	probably damaging	1.00
R3162:Copa	UTSW	1	172091233	missense	probably damaging	1.00
R3975:Copa	UTSW	1	172121245	missense	probably benign	0.00
R4031:Copa	UTSW	1	172108375	missense	probably damaging	1.00
R4155:Copa	UTSW	1	172101425	missense	probably damaging	1.00
R4227:Copa	UTSW	1	172118115	intron	probably benign
R4244:Copa	UTSW	1	172110718	missense	probably benign	0.00
R4254:Copa	UTSW	1	172102244	missense	probably damaging	1.00
R4291:Copa	UTSW	1	172092397	intron	probably benign
R4323:Copa	UTSW	1	172119264	missense	probably damaging	1.00
R4402:Copa	UTSW	1	172102224	missense	probably damaging	1.00
R4711:Copa	UTSW	1	172119988	missense	probably damaging	1.00
R4721:Copa	UTSW	1	172104274	splice site	probably benign
R4773:Copa	UTSW	1	172105220	missense	probably damaging	1.00
R4794:Copa	UTSW	1	172119321	missense	probably damaging	1.00
R4887:Copa	UTSW	1	172092276	missense	probably benign	0.39
R4953:Copa	UTSW	1	172082886	unclassified	probably benign
R5139:Copa	UTSW	1	172121329	missense	probably damaging	0.99
R5152:Copa	UTSW	1	172118061	missense	probably benign	0.34
R5297:Copa	UTSW	1	172113108	missense	probably damaging	1.00
R5586:Copa	UTSW	1	172105222	missense	probably damaging	1.00
R5698:Copa	UTSW	1	172118944	nonsense	probably null
R6283:Copa	UTSW	1	172118848	missense	possibly damaging	0.79
R6921:Copa	UTSW	1	172111924	missense	possibly damaging	0.63
R6934:Copa	UTSW	1	172110686	missense	possibly damaging	0.64
R7009:Copa	UTSW	1	172091000	missense	probably damaging	0.96
R7194:Copa	UTSW	1	172119944	missense	probably damaging	0.99
R7348:Copa	UTSW	1	172102223	missense	possibly damaging	0.96
R7710:Copa	UTSW	1	172109844	missense	possibly damaging	0.50
R7745:Copa	UTSW	1	172111942	missense	probably damaging	1.00
R7893:Copa	UTSW	1	172119565	nonsense	probably null
R8168:Copa	UTSW	1	172099672	missense	probably damaging	1.00
R8273:Copa	UTSW	1	172118979	critical splice donor site	probably null
R8704:Copa	UTSW	1	172104126	missense	probably benign	0.01
R8754:Copa	UTSW	1	172108359	missense	probably damaging	1.00
R8757:Copa	UTSW	1	172119514	missense	probably benign	0.04
R8759:Copa	UTSW	1	172119514	missense	probably benign	0.04
R8885:Copa	UTSW	1	172097745	missense	probably damaging	1.00
R8891:Copa	UTSW	1	172119251	missense	probably damaging	1.00
R8927:Copa	UTSW	1	172104170	missense	probably null	0.03
R8928:Copa	UTSW	1	172104170	missense	probably null	0.03
R8956:Copa	UTSW	1	172109913	missense	possibly damaging	0.65
R9063:Copa	UTSW	1	172116962	missense	probably benign	0.00
R9295:Copa	UTSW	1	172112256	missense	probably damaging	0.99
R9364:Copa	UTSW	1	172117264	missense	probably benign	0.00
R9437:Copa	UTSW	1	172104145	missense	possibly damaging	0.93
R9673:Copa	UTSW	1	172118081	missense	probably benign	0.11
T0722:Copa	UTSW	1	172111948	missense	possibly damaging	0.87
Z1177:Copa	UTSW	1	172106123	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AGTTACTTGCGTTGTCATGTCC -3'
(R):5'- GCAGATTTGCCCCTTGAAC -3'

Sequencing Primer
(F):5'- CAGGCTGTCCTAGAACTTGAGATC -3'
(R):5'- AGATTTGCCCCTTGAACTCAGGG -3'

Posted On

2015-04-30