Incidental Mutation 'R3973:Copa'
ID 312917
Institutional Source Beutler Lab
Gene Symbol Copa
Ensembl Gene ENSMUSG00000026553
Gene Name coatomer protein complex subunit alpha
Synonyms xenin
MMRRC Submission 040841-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.970) question?
Stock # R3973 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 171910096-171949897 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 171948812 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1155 (S1155T)
Ref Sequence ENSEMBL: ENSMUSP00000027833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027833] [ENSMUST00000135192]
AlphaFold Q8CIE6
Predicted Effect probably benign
Transcript: ENSMUST00000027833
AA Change: S1155T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000027833
Gene: ENSMUSG00000026553
AA Change: S1155T

DomainStartEndE-ValueType
WD40 2 37 2.86e0 SMART
WD40 40 79 1.11e-6 SMART
WD40 82 121 4.76e-6 SMART
WD40 124 163 2.24e-11 SMART
WD40 194 233 2.98e-7 SMART
WD40 238 277 8.42e-7 SMART
WD40 280 318 1.38e1 SMART
Pfam:Coatomer_WDAD 338 776 5.4e-144 PFAM
Pfam:COPI_C 824 1233 1.4e-190 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122845
Predicted Effect probably benign
Transcript: ENSMUST00000135192
AA Change: S1146T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118179
Gene: ENSMUSG00000026553
AA Change: S1146T

DomainStartEndE-ValueType
WD40 2 37 2.86e0 SMART
WD40 40 79 1.11e-6 SMART
WD40 82 121 4.76e-6 SMART
WD40 124 163 2.24e-11 SMART
WD40 194 233 2.98e-7 SMART
WD40 238 277 8.42e-7 SMART
WD40 280 318 1.38e1 SMART
Pfam:Coatomer_WDAD 338 767 1.1e-148 PFAM
Pfam:COPI_C 815 1224 3.6e-216 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142765
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In eukaryotic cells, protein transport between the endoplasmic reticulum and Golgi compartments is mediated in part by non-clathrin-coated vesicular coat proteins (COPs). Seven coat proteins have been identified, and they represent subunits of a complex known as coatomer. The subunits are designated alpha-COP, beta-COP, beta-prime-COP, gamma-COP, delta-COP, epsilon-COP, and zeta-COP. The alpha-COP, encoded by COPA, shares high sequence similarity with RET1P, the alpha subunit of the coatomer complex in yeast. Also, the N-terminal 25 amino acids of alpha-COP encode the bioactive peptide, xenin, which stimulates exocrine pancreatic secretion and may act as a gastrointestinal hormone. Alternative splicing results in multiple splice forms encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(6) : Gene trapped(6)

 

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 148,029,488 (GRCm39) I486T probably damaging Het
4933427D14Rik T C 11: 72,089,567 (GRCm39) R106G probably damaging Het
Cfap54 A G 10: 92,675,333 (GRCm39) S2863P possibly damaging Het
Crot T C 5: 9,027,541 (GRCm39) T264A probably benign Het
Ddx3y G A Y: 1,267,170 (GRCm39) A232V probably damaging Het
Dst T G 1: 34,050,979 (GRCm39) V25G probably benign Het
Ehbp1 C T 11: 22,087,867 (GRCm39) A406T probably benign Het
Eml5 A T 12: 98,768,724 (GRCm39) probably benign Het
Eps8 A T 6: 137,486,153 (GRCm39) M453K probably benign Het
Galnt3 T C 2: 65,937,374 (GRCm39) D112G possibly damaging Het
Glra4 C T X: 135,663,542 (GRCm39) A336T probably damaging Het
Gmppb A G 9: 107,927,338 (GRCm39) D95G probably benign Het
Gprc6a T C 10: 51,504,544 (GRCm39) Y100C possibly damaging Het
Gpx6 C A 13: 21,501,828 (GRCm39) S150Y probably damaging Het
Hsd17b3 A T 13: 64,207,300 (GRCm39) V247D probably damaging Het
Htr7 T C 19: 36,034,160 (GRCm39) D165G probably damaging Het
Igha T C 12: 113,219,972 (GRCm39) probably benign Het
Igsf10 A G 3: 59,239,345 (GRCm39) C279R probably damaging Het
Irak4 A G 15: 94,452,621 (GRCm39) E182G possibly damaging Het
Lipo3 A T 19: 33,535,723 (GRCm39) V274E probably damaging Het
Lrpprc A C 17: 85,078,269 (GRCm39) probably null Het
Mast1 T C 8: 85,645,393 (GRCm39) Y684C probably damaging Het
Mdn1 T C 4: 32,722,363 (GRCm39) F2382L probably benign Het
Mepe C T 5: 104,484,944 (GRCm39) P28L probably benign Het
Mrgpra3 T A 7: 47,239,414 (GRCm39) I171F probably benign Het
Muc2 T A 7: 141,300,541 (GRCm39) probably benign Het
Myh3 C T 11: 66,987,262 (GRCm39) Q1371* probably null Het
Nodal T A 10: 61,258,833 (GRCm39) V90E probably benign Het
Npas4 A T 19: 5,036,579 (GRCm39) H528Q probably benign Het
Nt5dc3 T C 10: 86,660,100 (GRCm39) V382A probably damaging Het
Pcdh18 G A 3: 49,709,035 (GRCm39) T293I probably damaging Het
Phf20l1 A G 15: 66,513,665 (GRCm39) D947G probably damaging Het
Phf8-ps A T 17: 33,285,405 (GRCm39) S466T probably benign Het
Pla2r1 A G 2: 60,279,306 (GRCm39) V758A probably benign Het
Plod2 G T 9: 92,480,672 (GRCm39) G422* probably null Het
Ppp1r12a T C 10: 108,089,341 (GRCm39) V660A probably benign Het
Prdm6 T C 18: 53,673,278 (GRCm39) I186T possibly damaging Het
Prkd3 G A 17: 79,266,570 (GRCm39) probably benign Het
Prrc2a A G 17: 35,376,908 (GRCm39) L734P probably damaging Het
Rnf128 C A X: 138,565,271 (GRCm39) L282I probably damaging Het
Rnf213 A G 11: 119,359,879 (GRCm39) N4424S Het
Scrn3 T C 2: 73,166,121 (GRCm39) S385P possibly damaging Het
Serpina1d A T 12: 103,734,107 (GRCm39) S66T probably benign Het
Setd3 T C 12: 108,131,417 (GRCm39) K3R possibly damaging Het
Slc2a7 A G 4: 150,242,667 (GRCm39) probably null Het
Smad4 G T 18: 73,810,807 (GRCm39) T59K possibly damaging Het
Spc25 A G 2: 69,032,945 (GRCm39) L60P probably damaging Het
Stam A C 2: 14,143,772 (GRCm39) H354P probably damaging Het
Tesk1 C T 4: 43,445,786 (GRCm39) P280S possibly damaging Het
Tmem120a C G 5: 135,765,131 (GRCm39) R254P probably benign Het
Traf5 T C 1: 191,729,837 (GRCm39) T405A probably benign Het
Trav7-4 A G 14: 53,699,119 (GRCm39) S89G probably benign Het
Tsc22d1 T C 14: 76,656,049 (GRCm39) S761P probably damaging Het
Ugt1a10 C A 1: 88,143,862 (GRCm39) H361N probably damaging Het
Ugt2b1 C A 5: 87,065,534 (GRCm39) V502L probably benign Het
Vip T A 10: 5,592,590 (GRCm39) S77T possibly damaging Het
Wdr72 A T 9: 74,125,979 (GRCm39) M1025L probably benign Het
Zfp541 A G 7: 15,806,147 (GRCm39) D94G probably damaging Het
Other mutations in Copa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Copa APN 1 171,938,255 (GRCm39) missense possibly damaging 0.87
IGL01360:Copa APN 1 171,915,155 (GRCm39) splice site probably null
IGL01434:Copa APN 1 171,947,128 (GRCm39) missense probably benign 0.00
IGL01744:Copa APN 1 171,940,756 (GRCm39) missense probably benign 0.01
IGL01837:Copa APN 1 171,946,419 (GRCm39) missense probably benign 0.01
IGL01988:Copa APN 1 171,945,831 (GRCm39) missense probably benign 0.09
IGL02059:Copa APN 1 171,927,320 (GRCm39) missense probably damaging 0.96
IGL02123:Copa APN 1 171,939,695 (GRCm39) missense probably damaging 1.00
IGL02731:Copa APN 1 171,929,785 (GRCm39) missense possibly damaging 0.77
IGL03114:Copa APN 1 171,946,835 (GRCm39) nonsense probably null
P0027:Copa UTSW 1 171,939,515 (GRCm39) missense possibly damaging 0.87
PIT4434001:Copa UTSW 1 171,933,742 (GRCm39) missense probably benign 0.00
R0233:Copa UTSW 1 171,915,234 (GRCm39) critical splice donor site probably null
R0465:Copa UTSW 1 171,945,872 (GRCm39) missense probably damaging 1.00
R0547:Copa UTSW 1 171,949,254 (GRCm39) splice site probably benign
R0568:Copa UTSW 1 171,939,704 (GRCm39) missense possibly damaging 0.91
R0628:Copa UTSW 1 171,918,592 (GRCm39) splice site probably benign
R1328:Copa UTSW 1 171,949,258 (GRCm39) splice site probably benign
R1494:Copa UTSW 1 171,931,694 (GRCm39) missense probably benign 0.27
R1728:Copa UTSW 1 171,939,554 (GRCm39) missense probably benign
R1758:Copa UTSW 1 171,931,711 (GRCm39) missense probably damaging 1.00
R1784:Copa UTSW 1 171,939,554 (GRCm39) missense probably benign
R1942:Copa UTSW 1 171,939,455 (GRCm39) missense probably damaging 1.00
R2054:Copa UTSW 1 171,946,524 (GRCm39) nonsense probably null
R2299:Copa UTSW 1 171,949,292 (GRCm39) missense probably benign 0.10
R2518:Copa UTSW 1 171,947,468 (GRCm39) missense probably benign
R2680:Copa UTSW 1 171,948,971 (GRCm39) nonsense probably null
R3080:Copa UTSW 1 171,940,716 (GRCm39) missense probably damaging 1.00
R3160:Copa UTSW 1 171,918,800 (GRCm39) missense probably damaging 1.00
R3161:Copa UTSW 1 171,918,800 (GRCm39) missense probably damaging 1.00
R3162:Copa UTSW 1 171,918,800 (GRCm39) missense probably damaging 1.00
R3162:Copa UTSW 1 171,918,800 (GRCm39) missense probably damaging 1.00
R3975:Copa UTSW 1 171,948,812 (GRCm39) missense probably benign 0.00
R4031:Copa UTSW 1 171,935,942 (GRCm39) missense probably damaging 1.00
R4155:Copa UTSW 1 171,928,992 (GRCm39) missense probably damaging 1.00
R4227:Copa UTSW 1 171,945,682 (GRCm39) intron probably benign
R4244:Copa UTSW 1 171,938,285 (GRCm39) missense probably benign 0.00
R4254:Copa UTSW 1 171,929,811 (GRCm39) missense probably damaging 1.00
R4291:Copa UTSW 1 171,919,964 (GRCm39) intron probably benign
R4323:Copa UTSW 1 171,946,831 (GRCm39) missense probably damaging 1.00
R4402:Copa UTSW 1 171,929,791 (GRCm39) missense probably damaging 1.00
R4711:Copa UTSW 1 171,947,555 (GRCm39) missense probably damaging 1.00
R4721:Copa UTSW 1 171,931,841 (GRCm39) splice site probably benign
R4773:Copa UTSW 1 171,932,787 (GRCm39) missense probably damaging 1.00
R4794:Copa UTSW 1 171,946,888 (GRCm39) missense probably damaging 1.00
R4887:Copa UTSW 1 171,919,843 (GRCm39) missense probably benign 0.39
R4953:Copa UTSW 1 171,910,453 (GRCm39) unclassified probably benign
R5139:Copa UTSW 1 171,948,896 (GRCm39) missense probably damaging 0.99
R5152:Copa UTSW 1 171,945,628 (GRCm39) missense probably benign 0.34
R5297:Copa UTSW 1 171,940,675 (GRCm39) missense probably damaging 1.00
R5586:Copa UTSW 1 171,932,789 (GRCm39) missense probably damaging 1.00
R5698:Copa UTSW 1 171,946,511 (GRCm39) nonsense probably null
R6283:Copa UTSW 1 171,946,415 (GRCm39) missense possibly damaging 0.79
R6921:Copa UTSW 1 171,939,491 (GRCm39) missense possibly damaging 0.63
R6934:Copa UTSW 1 171,938,253 (GRCm39) missense possibly damaging 0.64
R7009:Copa UTSW 1 171,918,567 (GRCm39) missense probably damaging 0.96
R7194:Copa UTSW 1 171,947,511 (GRCm39) missense probably damaging 0.99
R7348:Copa UTSW 1 171,929,790 (GRCm39) missense possibly damaging 0.96
R7710:Copa UTSW 1 171,937,411 (GRCm39) missense possibly damaging 0.50
R7745:Copa UTSW 1 171,939,509 (GRCm39) missense probably damaging 1.00
R7893:Copa UTSW 1 171,947,132 (GRCm39) nonsense probably null
R8168:Copa UTSW 1 171,927,239 (GRCm39) missense probably damaging 1.00
R8273:Copa UTSW 1 171,946,546 (GRCm39) critical splice donor site probably null
R8704:Copa UTSW 1 171,931,693 (GRCm39) missense probably benign 0.01
R8754:Copa UTSW 1 171,935,926 (GRCm39) missense probably damaging 1.00
R8757:Copa UTSW 1 171,947,081 (GRCm39) missense probably benign 0.04
R8759:Copa UTSW 1 171,947,081 (GRCm39) missense probably benign 0.04
R8885:Copa UTSW 1 171,925,312 (GRCm39) missense probably damaging 1.00
R8891:Copa UTSW 1 171,946,818 (GRCm39) missense probably damaging 1.00
R8927:Copa UTSW 1 171,931,737 (GRCm39) missense probably null 0.03
R8928:Copa UTSW 1 171,931,737 (GRCm39) missense probably null 0.03
R8956:Copa UTSW 1 171,937,480 (GRCm39) missense possibly damaging 0.65
R9063:Copa UTSW 1 171,944,529 (GRCm39) missense probably benign 0.00
R9295:Copa UTSW 1 171,939,823 (GRCm39) missense probably damaging 0.99
R9364:Copa UTSW 1 171,944,831 (GRCm39) missense probably benign 0.00
R9437:Copa UTSW 1 171,931,712 (GRCm39) missense possibly damaging 0.93
R9673:Copa UTSW 1 171,945,648 (GRCm39) missense probably benign 0.11
T0722:Copa UTSW 1 171,939,515 (GRCm39) missense possibly damaging 0.87
Z1177:Copa UTSW 1 171,933,690 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTTACTTGCGTTGTCATGTCC -3'
(R):5'- GCAGATTTGCCCCTTGAAC -3'

Sequencing Primer
(F):5'- CAGGCTGTCCTAGAACTTGAGATC -3'
(R):5'- AGATTTGCCCCTTGAACTCAGGG -3'
Posted On 2015-04-30