Incidental Mutation 'R0386:Hmbs'
ID31292
Institutional Source Beutler Lab
Gene Symbol Hmbs
Ensembl Gene ENSMUSG00000032126
Gene Namehydroxymethylbilane synthase
Synonymsporphobilinogen deaminase, PBGD, Uros1, Ups
MMRRC Submission 038592-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0386 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location44336339-44344228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44337008 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 260 (Y260C)
Ref Sequence ENSEMBL: ENSMUSP00000095166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052686] [ENSMUST00000054708] [ENSMUST00000077353] [ENSMUST00000097558] [ENSMUST00000215050] [ENSMUST00000215091] [ENSMUST00000216852]
Predicted Effect probably benign
Transcript: ENSMUST00000052686
SMART Domains Protein: ENSMUSP00000051432
Gene: ENSMUSG00000049932

DomainStartEndE-ValueType
H2A 3 123 1.64e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054708
SMART Domains Protein: ENSMUSP00000056282
Gene: ENSMUSG00000032123

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
Pfam:Glycos_transf_4 100 272 1.1e-38 PFAM
transmembrane domain 277 299 N/A INTRINSIC
transmembrane domain 381 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077353
AA Change: Y277C

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000076575
Gene: ENSMUSG00000032126
AA Change: Y277C

DomainStartEndE-ValueType
Pfam:Porphobil_deam 21 233 1.7e-79 PFAM
Pfam:Porphobil_deamC 244 323 6.8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097558
AA Change: Y260C

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000095166
Gene: ENSMUSG00000032126
AA Change: Y260C

DomainStartEndE-ValueType
Pfam:Porphobil_deam 3 219 3.9e-95 PFAM
Pfam:Porphobil_deamC 227 327 4.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213709
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214967
Predicted Effect probably benign
Transcript: ENSMUST00000215050
Predicted Effect probably benign
Transcript: ENSMUST00000215091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215934
Predicted Effect unknown
Transcript: ENSMUST00000216658
AA Change: Y93C
Predicted Effect probably benign
Transcript: ENSMUST00000216852
Meta Mutation Damage Score 0.222 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for one null allele and a functional allele with a milder mutation exhibit typical features of acute intermittent porphyria with massive urinary excretion of aminolevulinic acid after phenobarbital treatment, erythruria, ataxia, motor dysfunction, and neurologic muscle atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,896,461 V194A probably damaging Het
Adamts13 G A 2: 26,986,679 probably null Het
Ahnak T C 19: 9,011,144 M3264T possibly damaging Het
Birc6 T A 17: 74,599,340 C1409S probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Dnah2 A G 11: 69,447,861 V3161A probably damaging Het
Dnah5 A T 15: 28,383,581 Y2983F probably damaging Het
Dnah6 G A 6: 73,083,124 L2774F probably damaging Het
Dst A T 1: 34,217,836 T4398S probably damaging Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Efcab5 A T 11: 77,172,378 M96K probably benign Het
Elavl4 A G 4: 110,206,705 probably benign Het
Flt4 G A 11: 49,644,386 A1214T probably benign Het
Fn1 G T 1: 71,595,786 T2127N probably damaging Het
Foxj1 A T 11: 116,331,803 S391R possibly damaging Het
Gabrb1 A T 5: 72,108,807 Y269F probably damaging Het
Ghitm A G 14: 37,125,911 S259P possibly damaging Het
Gm16332 A G 1: 139,924,190 noncoding transcript Het
Gm16380 T A 9: 53,884,443 noncoding transcript Het
Gm9869 A T 9: 60,838,062 probably benign Het
Gm9936 G A 5: 114,857,131 Q142* probably null Het
Hoxc5 T A 15: 103,015,352 C193* probably null Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Lce1j T C 3: 92,789,388 K28E unknown Het
Lpgat1 C T 1: 191,719,348 probably benign Het
Lyst T C 13: 13,708,214 probably benign Het
Megf11 A G 9: 64,640,078 N235D probably damaging Het
Mst1r T A 9: 107,916,804 probably null Het
Nr2c2ap A G 8: 70,131,587 D9G probably benign Het
Obscn T C 11: 59,136,339 T13A probably damaging Het
Ofcc1 A C 13: 40,214,474 L188* probably null Het
Olfr1028 A G 2: 85,951,873 E270G probably damaging Het
Olfr432 A T 1: 174,050,399 T9S probably benign Het
Oma1 A T 4: 103,325,201 probably benign Het
Pcm1 T C 8: 41,316,023 F1642S probably damaging Het
Pglyrp2 A G 17: 32,420,862 M1T probably null Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prdm10 C A 9: 31,316,300 T67K probably damaging Het
Ralgapa1 A T 12: 55,708,067 H1193Q probably benign Het
Sall1 A G 8: 89,032,604 S291P probably damaging Het
Sdk2 T C 11: 113,893,464 T150A probably damaging Het
Sel1l2 T A 2: 140,275,441 Y170F probably benign Het
Sema4a C T 3: 88,436,800 V715I possibly damaging Het
Smgc G A 15: 91,854,638 A500T probably benign Het
Spef2 A G 15: 9,584,062 V1639A probably damaging Het
Srrm4 A G 5: 116,482,378 probably benign Het
Tbc1d23 G A 16: 57,189,273 H418Y probably damaging Het
Tbk1 A G 10: 121,584,254 L10P probably damaging Het
Thumpd3 G A 6: 113,065,660 probably null Het
Trp53bp1 G T 2: 121,204,943 T1609K probably damaging Het
Tut1 A G 19: 8,955,555 N84S probably benign Het
Urb1 C T 16: 90,796,399 G282R probably damaging Het
Usp19 A T 9: 108,499,711 D1160V probably damaging Het
Usp9y A G Y: 1,316,933 V1872A probably damaging Het
Zfp276 C A 8: 123,259,503 Y386* probably null Het
Other mutations in Hmbs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01526:Hmbs APN 9 44339548 missense possibly damaging 0.91
IGL02312:Hmbs APN 9 44341213 critical splice donor site probably null
R0411:Hmbs UTSW 9 44341652 nonsense probably null
R0656:Hmbs UTSW 9 44337360 missense probably benign 0.31
R1503:Hmbs UTSW 9 44337432 missense probably benign 0.42
R1560:Hmbs UTSW 9 44337360 missense possibly damaging 0.71
R1953:Hmbs UTSW 9 44337444 missense probably damaging 1.00
R2127:Hmbs UTSW 9 44340707 missense probably benign 0.09
R4637:Hmbs UTSW 9 44339537 missense probably damaging 1.00
R5549:Hmbs UTSW 9 44339477 critical splice donor site probably null
R6611:Hmbs UTSW 9 44341691 missense probably damaging 0.98
R7509:Hmbs UTSW 9 44336911 missense
X0024:Hmbs UTSW 9 44337968 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CTGGACCATCTTCTTGCTGGATGAC -3'
(R):5'- CTGAAACTCTGCTTCGCTGCATTG -3'

Sequencing Primer
(F):5'- ATCTTCTTGCTGGATGACAGGTTAC -3'
(R):5'- CTTCGCTGCATTGCTGAAAG -3'
Posted On2013-04-24