Incidental Mutation 'R3973:Galnt3'
ID 312921
Institutional Source Beutler Lab
Gene Symbol Galnt3
Ensembl Gene ENSMUSG00000026994
Gene Name polypeptide N-acetylgalactosaminyltransferase 3
Synonyms ppGaNTase-T3
MMRRC Submission 040841-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock # R3973 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 66082766-66124994 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66107030 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 112 (D112G)
Ref Sequence ENSEMBL: ENSMUSP00000028378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028378]
AlphaFold P70419
Predicted Effect possibly damaging
Transcript: ENSMUST00000028378
AA Change: D112G

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028378
Gene: ENSMUSG00000026994
AA Change: D112G

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
coiled coil region 44 75 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 185 440 8.3e-10 PFAM
Pfam:Glycos_transf_2 188 374 1.2e-35 PFAM
Pfam:Glyco_transf_7C 345 423 7.7e-14 PFAM
RICIN 506 630 2.71e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153563
Meta Mutation Damage Score 0.0826 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes UDP-GalNAc transferase 3, a member of the GalNAc-transferases family. This family transfers an N-acetyl galactosamine to the hydroxyl group of a serine or threonine residue in the first step of O-linked oligosaccharide biosynthesis. Individual GalNAc-transferases have distinct activities and initiation of O-glycosylation is regulated by a repertoire of GalNAc-transferases. The protein encoded by this gene is highly homologous to other family members, however the enzymes have different substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating alkaline phosphatase, hypercalcemia, hyperphosphatemia, decreased circulating parathyroid hormone, and male specific postnatal growth retardation, infertility, and increase in bone density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,031 I486T probably damaging Het
4921501E09Rik A T 17: 33,066,431 S466T probably benign Het
4933427D14Rik T C 11: 72,198,741 R106G probably damaging Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Copa T A 1: 172,121,245 S1155T probably benign Het
Crot T C 5: 8,977,541 T264A probably benign Het
Ddx3y G A Y: 1,267,170 A232V probably damaging Het
Dst T G 1: 34,011,898 V25G probably benign Het
Ehbp1 C T 11: 22,137,867 A406T probably benign Het
Eml5 A T 12: 98,802,465 probably benign Het
Eps8 A T 6: 137,509,155 M453K probably benign Het
Glra4 C T X: 136,762,793 A336T probably damaging Het
Gmppb A G 9: 108,050,139 D95G probably benign Het
Gprc6a T C 10: 51,628,448 Y100C possibly damaging Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Hsd17b3 A T 13: 64,059,486 V247D probably damaging Het
Htr7 T C 19: 36,056,760 D165G probably damaging Het
Igha T C 12: 113,256,352 probably benign Het
Igsf10 A G 3: 59,331,924 C279R probably damaging Het
Irak4 A G 15: 94,554,740 E182G possibly damaging Het
Lipo3 A T 19: 33,558,323 V274E probably damaging Het
Lrpprc A C 17: 84,770,841 probably null Het
Mast1 T C 8: 84,918,764 Y684C probably damaging Het
Mdn1 T C 4: 32,722,363 F2382L probably benign Het
Mepe C T 5: 104,337,078 P28L probably benign Het
Mrgpra3 T A 7: 47,589,666 I171F probably benign Het
Muc2 T A 7: 141,746,804 probably benign Het
Myh3 C T 11: 67,096,436 Q1371* probably null Het
Nodal T A 10: 61,423,054 V90E probably benign Het
Npas4 A T 19: 4,986,551 H528Q probably benign Het
Nt5dc3 T C 10: 86,824,236 V382A probably damaging Het
Pcdh18 G A 3: 49,754,586 T293I probably damaging Het
Phf20l1 A G 15: 66,641,816 D947G probably damaging Het
Pla2r1 A G 2: 60,448,962 V758A probably benign Het
Plod2 G T 9: 92,598,619 G422* probably null Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Prkd3 G A 17: 78,959,141 probably benign Het
Prrc2a A G 17: 35,157,932 L734P probably damaging Het
Rnf128 C A X: 139,664,522 L282I probably damaging Het
Rnf213 A G 11: 119,469,053 N4424S Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Serpina1d A T 12: 103,767,848 S66T probably benign Het
Setd3 T C 12: 108,165,158 K3R possibly damaging Het
Slc2a7 A G 4: 150,158,210 probably null Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Spc25 A G 2: 69,202,601 L60P probably damaging Het
Stam A C 2: 14,138,961 H354P probably damaging Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Tmem120a C G 5: 135,736,277 R254P probably benign Het
Traf5 T C 1: 191,997,876 T405A probably benign Het
Trav7-4 A G 14: 53,461,662 S89G probably benign Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Ugt2b1 C A 5: 86,917,675 V502L probably benign Het
Vip T A 10: 5,642,590 S77T possibly damaging Het
Wdr72 A T 9: 74,218,697 M1025L probably benign Het
Zfp541 A G 7: 16,072,222 D94G probably damaging Het
Other mutations in Galnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Galnt3 APN 2 66095284 missense probably damaging 1.00
IGL01563:Galnt3 APN 2 66097757 missense probably damaging 0.97
IGL01973:Galnt3 APN 2 66084262 missense probably benign 0.03
IGL02004:Galnt3 APN 2 66095926 missense probably damaging 1.00
IGL02424:Galnt3 APN 2 66095788 critical splice donor site probably null
IGL02946:Galnt3 APN 2 66095218 missense probably damaging 0.99
IGL03059:Galnt3 APN 2 66093610 missense probably damaging 1.00
PIT4531001:Galnt3 UTSW 2 66107088 missense probably benign 0.03
R0437:Galnt3 UTSW 2 66107229 missense possibly damaging 0.74
R1390:Galnt3 UTSW 2 66091223 missense probably damaging 1.00
R1536:Galnt3 UTSW 2 66084206 missense probably damaging 1.00
R1869:Galnt3 UTSW 2 66097779 missense possibly damaging 0.82
R2987:Galnt3 UTSW 2 66084241 missense probably benign 0.00
R4039:Galnt3 UTSW 2 66085327 missense probably damaging 0.96
R4515:Galnt3 UTSW 2 66093610 missense probably damaging 1.00
R4518:Galnt3 UTSW 2 66093610 missense probably damaging 1.00
R4519:Galnt3 UTSW 2 66093610 missense probably damaging 1.00
R4577:Galnt3 UTSW 2 66097859 missense probably benign 0.02
R4817:Galnt3 UTSW 2 66093539 missense possibly damaging 0.83
R5008:Galnt3 UTSW 2 66085241 missense probably benign 0.04
R5191:Galnt3 UTSW 2 66093706 missense probably damaging 1.00
R5947:Galnt3 UTSW 2 66084156 utr 3 prime probably benign
R6534:Galnt3 UTSW 2 66102531 missense probably damaging 1.00
R7196:Galnt3 UTSW 2 66090924 missense probably damaging 1.00
R7817:Galnt3 UTSW 2 66095899 missense probably damaging 1.00
R7951:Galnt3 UTSW 2 66097842 missense probably benign 0.00
R7952:Galnt3 UTSW 2 66097842 missense probably benign 0.00
R8071:Galnt3 UTSW 2 66091211 missense probably benign 0.28
R8513:Galnt3 UTSW 2 66093720 nonsense probably null
R8844:Galnt3 UTSW 2 66085292 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACATACTCAGGTGGTCGGGTG -3'
(R):5'- AAGTGTTCAGTATTCCAAGGAGG -3'

Sequencing Primer
(F):5'- TGTCAGGCCCAAGGTCC -3'
(R):5'- TCCAAGGAGGAATCAAAGATGG -3'
Posted On 2015-04-30