Mutagenetix > Incidental Mutation

Incidental Mutation 'R3973:Galnt3'

312921

Institutional Source

Beutler Lab

Gene Symbol

Galnt3

Ensembl Gene

ENSMUSG00000026994

Gene Name

polypeptide N-acetylgalactosaminyltransferase 3

Synonyms

ppGaNTase-T3

MMRRC Submission

040841-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.335) question?

Stock #

R3973 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66082766-66124994 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 66107030 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 112 (D112G)

Ref Sequence

ENSEMBL: ENSMUSP00000028378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028378]

AlphaFold

P70419

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028378
AA Change: D112G

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000028378
Gene: ENSMUSG00000026994
AA Change: D112G

Domain	Start	End	E-Value	Type
transmembrane domain	20	37	N/A	INTRINSIC
coiled coil region	44	75	N/A	INTRINSIC
Pfam:Glyco_tranf_2_3	185	440	8.3e-10	PFAM
Pfam:Glycos_transf_2	188	374	1.2e-35	PFAM
Pfam:Glyco_transf_7C	345	423	7.7e-14	PFAM
RICIN	506	630	2.71e-28	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153563

Meta Mutation Damage Score

0.0826

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.3%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes UDP-GalNAc transferase 3, a member of the GalNAc-transferases family. This family transfers an N-acetyl galactosamine to the hydroxyl group of a serine or threonine residue in the first step of O-linked oligosaccharide biosynthesis. Individual GalNAc-transferases have distinct activities and initiation of O-glycosylation is regulated by a repertoire of GalNAc-transferases. The protein encoded by this gene is highly homologous to other family members, however the enzymes have different substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating alkaline phosphatase, hypercalcemia, hyperphosphatemia, decreased circulating parathyroid hormone, and male specific postnatal growth retardation, infertility, and increase in bone density. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	T	C	4: 147,945,031	I486T	probably damaging	Het
4921501E09Rik	A	T	17: 33,066,431	S466T	probably benign	Het
4933427D14Rik	T	C	11: 72,198,741	R106G	probably damaging	Het
Cfap54	A	G	10: 92,839,471	S2863P	possibly damaging	Het
Copa	T	A	1: 172,121,245	S1155T	probably benign	Het
Crot	T	C	5: 8,977,541	T264A	probably benign	Het
Ddx3y	G	A	Y: 1,267,170	A232V	probably damaging	Het
Dst	T	G	1: 34,011,898	V25G	probably benign	Het
Ehbp1	C	T	11: 22,137,867	A406T	probably benign	Het
Eml5	A	T	12: 98,802,465		probably benign	Het
Eps8	A	T	6: 137,509,155	M453K	probably benign	Het
Glra4	C	T	X: 136,762,793	A336T	probably damaging	Het
Gmppb	A	G	9: 108,050,139	D95G	probably benign	Het
Gprc6a	T	C	10: 51,628,448	Y100C	possibly damaging	Het
Gpx6	C	A	13: 21,317,658	S150Y	probably damaging	Het
Hsd17b3	A	T	13: 64,059,486	V247D	probably damaging	Het
Htr7	T	C	19: 36,056,760	D165G	probably damaging	Het
Igha	T	C	12: 113,256,352		probably benign	Het
Igsf10	A	G	3: 59,331,924	C279R	probably damaging	Het
Irak4	A	G	15: 94,554,740	E182G	possibly damaging	Het
Lipo3	A	T	19: 33,558,323	V274E	probably damaging	Het
Lrpprc	A	C	17: 84,770,841		probably null	Het
Mast1	T	C	8: 84,918,764	Y684C	probably damaging	Het
Mdn1	T	C	4: 32,722,363	F2382L	probably benign	Het
Mepe	C	T	5: 104,337,078	P28L	probably benign	Het
Mrgpra3	T	A	7: 47,589,666	I171F	probably benign	Het
Muc2	T	A	7: 141,746,804		probably benign	Het
Myh3	C	T	11: 67,096,436	Q1371*	probably null	Het
Nodal	T	A	10: 61,423,054	V90E	probably benign	Het
Npas4	A	T	19: 4,986,551	H528Q	probably benign	Het
Nt5dc3	T	C	10: 86,824,236	V382A	probably damaging	Het
Pcdh18	G	A	3: 49,754,586	T293I	probably damaging	Het
Phf20l1	A	G	15: 66,641,816	D947G	probably damaging	Het
Pla2r1	A	G	2: 60,448,962	V758A	probably benign	Het
Plod2	G	T	9: 92,598,619	G422*	probably null	Het
Ppp1r12a	T	C	10: 108,253,480	V660A	probably benign	Het
Prdm6	T	C	18: 53,540,206	I186T	possibly damaging	Het
Prkd3	G	A	17: 78,959,141		probably benign	Het
Prrc2a	A	G	17: 35,157,932	L734P	probably damaging	Het
Rnf128	C	A	X: 139,664,522	L282I	probably damaging	Het
Rnf213	A	G	11: 119,469,053	N4424S		Het
Scrn3	T	C	2: 73,335,777	S385P	possibly damaging	Het
Serpina1d	A	T	12: 103,767,848	S66T	probably benign	Het
Setd3	T	C	12: 108,165,158	K3R	possibly damaging	Het
Slc2a7	A	G	4: 150,158,210		probably null	Het
Smad4	G	T	18: 73,677,736	T59K	possibly damaging	Het
Spc25	A	G	2: 69,202,601	L60P	probably damaging	Het
Stam	A	C	2: 14,138,961	H354P	probably damaging	Het
Tesk1	C	T	4: 43,445,786	P280S	possibly damaging	Het
Tmem120a	C	G	5: 135,736,277	R254P	probably benign	Het
Traf5	T	C	1: 191,997,876	T405A	probably benign	Het
Trav7-4	A	G	14: 53,461,662	S89G	probably benign	Het
Tsc22d1	T	C	14: 76,418,609	S761P	probably damaging	Het
Ugt1a10	C	A	1: 88,216,140	H361N	probably damaging	Het
Ugt2b1	C	A	5: 86,917,675	V502L	probably benign	Het
Vip	T	A	10: 5,642,590	S77T	possibly damaging	Het
Wdr72	A	T	9: 74,218,697	M1025L	probably benign	Het
Zfp541	A	G	7: 16,072,222	D94G	probably damaging	Het

Other mutations in Galnt3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Galnt3	APN	2	66095284	missense	probably damaging	1.00
IGL01563:Galnt3	APN	2	66097757	missense	probably damaging	0.97
IGL01973:Galnt3	APN	2	66084262	missense	probably benign	0.03
IGL02004:Galnt3	APN	2	66095926	missense	probably damaging	1.00
IGL02424:Galnt3	APN	2	66095788	critical splice donor site	probably null
IGL02946:Galnt3	APN	2	66095218	missense	probably damaging	0.99
IGL03059:Galnt3	APN	2	66093610	missense	probably damaging	1.00
PIT4531001:Galnt3	UTSW	2	66107088	missense	probably benign	0.03
R0437:Galnt3	UTSW	2	66107229	missense	possibly damaging	0.74
R1390:Galnt3	UTSW	2	66091223	missense	probably damaging	1.00
R1536:Galnt3	UTSW	2	66084206	missense	probably damaging	1.00
R1869:Galnt3	UTSW	2	66097779	missense	possibly damaging	0.82
R2987:Galnt3	UTSW	2	66084241	missense	probably benign	0.00
R4039:Galnt3	UTSW	2	66085327	missense	probably damaging	0.96
R4515:Galnt3	UTSW	2	66093610	missense	probably damaging	1.00
R4518:Galnt3	UTSW	2	66093610	missense	probably damaging	1.00
R4519:Galnt3	UTSW	2	66093610	missense	probably damaging	1.00
R4577:Galnt3	UTSW	2	66097859	missense	probably benign	0.02
R4817:Galnt3	UTSW	2	66093539	missense	possibly damaging	0.83
R5008:Galnt3	UTSW	2	66085241	missense	probably benign	0.04
R5191:Galnt3	UTSW	2	66093706	missense	probably damaging	1.00
R5947:Galnt3	UTSW	2	66084156	utr 3 prime	probably benign
R6534:Galnt3	UTSW	2	66102531	missense	probably damaging	1.00
R7196:Galnt3	UTSW	2	66090924	missense	probably damaging	1.00
R7817:Galnt3	UTSW	2	66095899	missense	probably damaging	1.00
R7951:Galnt3	UTSW	2	66097842	missense	probably benign	0.00
R7952:Galnt3	UTSW	2	66097842	missense	probably benign	0.00
R8071:Galnt3	UTSW	2	66091211	missense	probably benign	0.28
R8513:Galnt3	UTSW	2	66093720	nonsense	probably null
R8844:Galnt3	UTSW	2	66085292	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AACATACTCAGGTGGTCGGGTG -3'
(R):5'- AAGTGTTCAGTATTCCAAGGAGG -3'

Sequencing Primer
(F):5'- TGTCAGGCCCAAGGTCC -3'
(R):5'- TCCAAGGAGGAATCAAAGATGG -3'

Posted On

2015-04-30