Incidental Mutation 'R3973:Spc25'
ID312922
Institutional Source Beutler Lab
Gene Symbol Spc25
Ensembl Gene ENSMUSG00000005233
Gene NameSPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae)
Synonyms2600017H08Rik, Spbc25, 2610205L13Rik
MMRRC Submission 040841-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R3973 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location69193895-69206194 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69202601 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 60 (L60P)
Ref Sequence ENSEMBL: ENSMUSP00000128039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005365] [ENSMUST00000112320] [ENSMUST00000127243] [ENSMUST00000149045] [ENSMUST00000149643] [ENSMUST00000167875]
Predicted Effect probably damaging
Transcript: ENSMUST00000005365
AA Change: L108P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005365
Gene: ENSMUSG00000005233
AA Change: L108P

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
Pfam:Spindle_Spc25 148 222 6.3e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112320
AA Change: L108P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107939
Gene: ENSMUSG00000005233
AA Change: L108P

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
Pfam:Spindle_Spc25 150 221 1.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126638
Predicted Effect probably damaging
Transcript: ENSMUST00000127243
AA Change: L93P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120142
Gene: ENSMUSG00000005233
AA Change: L93P

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 30 44 N/A INTRINSIC
coiled coil region 57 113 N/A INTRINSIC
Pfam:Spindle_Spc25 133 207 4.5e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149045
AA Change: L60P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120999
Gene: ENSMUSG00000005233
AA Change: L60P

DomainStartEndE-ValueType
Pfam:Spindle_Spc25 100 133 3.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149401
Predicted Effect probably damaging
Transcript: ENSMUST00000149643
AA Change: L108P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117415
Gene: ENSMUSG00000005233
AA Change: L108P

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
PDB:3IZ0|E 99 167 3e-22 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150505
Predicted Effect probably damaging
Transcript: ENSMUST00000167875
AA Change: L60P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128039
Gene: ENSMUSG00000005233
AA Change: L60P

DomainStartEndE-ValueType
Pfam:Spindle_Spc25 100 174 1.7e-27 PFAM
Meta Mutation Damage Score 0.6102 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: This gene encodes a component of the kinetochore-associated NDC80 protein complex, which is required for the mitotic spindle checkpoint and for microtubule-kinetochore attachment. During meiosis in mouse, the protein localizes to the germinal vesicle and then is associated with the chromosomes following germinal vesicle breakdown. Knockdown of this gene in oocytes results in precocious polar body extrusion, chromosome misalignment and aberrant spindle formation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,031 I486T probably damaging Het
4921501E09Rik A T 17: 33,066,431 S466T probably benign Het
4933427D14Rik T C 11: 72,198,741 R106G probably damaging Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Copa T A 1: 172,121,245 S1155T probably benign Het
Crot T C 5: 8,977,541 T264A probably benign Het
Ddx3y G A Y: 1,267,170 A232V probably damaging Het
Dst T G 1: 34,011,898 V25G probably benign Het
Ehbp1 C T 11: 22,137,867 A406T probably benign Het
Eml5 A T 12: 98,802,465 probably benign Het
Eps8 A T 6: 137,509,155 M453K probably benign Het
Galnt3 T C 2: 66,107,030 D112G possibly damaging Het
Glra4 C T X: 136,762,793 A336T probably damaging Het
Gmppb A G 9: 108,050,139 D95G probably benign Het
Gprc6a T C 10: 51,628,448 Y100C possibly damaging Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Hsd17b3 A T 13: 64,059,486 V247D probably damaging Het
Htr7 T C 19: 36,056,760 D165G probably damaging Het
Igha T C 12: 113,256,352 probably benign Het
Igsf10 A G 3: 59,331,924 C279R probably damaging Het
Irak4 A G 15: 94,554,740 E182G possibly damaging Het
Lipo3 A T 19: 33,558,323 V274E probably damaging Het
Lrpprc A C 17: 84,770,841 probably null Het
Mast1 T C 8: 84,918,764 Y684C probably damaging Het
Mdn1 T C 4: 32,722,363 F2382L probably benign Het
Mepe C T 5: 104,337,078 P28L probably benign Het
Mrgpra3 T A 7: 47,589,666 I171F probably benign Het
Muc2 T A 7: 141,746,804 probably benign Het
Myh3 C T 11: 67,096,436 Q1371* probably null Het
Nodal T A 10: 61,423,054 V90E probably benign Het
Npas4 A T 19: 4,986,551 H528Q probably benign Het
Nt5dc3 T C 10: 86,824,236 V382A probably damaging Het
Pcdh18 G A 3: 49,754,586 T293I probably damaging Het
Phf20l1 A G 15: 66,641,816 D947G probably damaging Het
Pla2r1 A G 2: 60,448,962 V758A probably benign Het
Plod2 G T 9: 92,598,619 G422* probably null Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Prkd3 G A 17: 78,959,141 probably benign Het
Prrc2a A G 17: 35,157,932 L734P probably damaging Het
Rnf128 C A X: 139,664,522 L282I probably damaging Het
Rnf213 A G 11: 119,469,053 N4424S probably benign Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Serpina1d A T 12: 103,767,848 S66T probably benign Het
Setd3 T C 12: 108,165,158 K3R possibly damaging Het
Slc2a7 A G 4: 150,158,210 probably null Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Stam A C 2: 14,138,961 H354P probably damaging Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Tmem120a C G 5: 135,736,277 R254P probably benign Het
Traf5 T C 1: 191,997,876 T405A probably benign Het
Trav7-4 A G 14: 53,461,662 S89G probably benign Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Ugt2b1 C A 5: 86,917,675 V502L probably benign Het
Vip T A 10: 5,642,590 S77T possibly damaging Het
Wdr72 A T 9: 74,218,697 M1025L probably benign Het
Zfp541 A G 7: 16,072,222 D94G probably damaging Het
Other mutations in Spc25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01757:Spc25 APN 2 69202608 nonsense probably null
IGL02273:Spc25 APN 2 69204929 splice site probably benign
IGL03163:Spc25 APN 2 69197204 missense probably damaging 1.00
R1519:Spc25 UTSW 2 69200087 missense probably damaging 1.00
R1604:Spc25 UTSW 2 69205154 missense probably damaging 0.99
R2913:Spc25 UTSW 2 69199987 missense probably benign 0.42
R4094:Spc25 UTSW 2 69202631 missense probably damaging 1.00
R4444:Spc25 UTSW 2 69204876 missense probably benign 0.06
R5293:Spc25 UTSW 2 69202652 missense possibly damaging 0.92
R6242:Spc25 UTSW 2 69197211 missense probably damaging 1.00
R6433:Spc25 UTSW 2 69206102 utr 5 prime probably benign
R6721:Spc25 UTSW 2 69197173 missense possibly damaging 0.96
R7712:Spc25 UTSW 2 69206137 missense unknown
R7866:Spc25 UTSW 2 69206062 critical splice donor site probably null
R8054:Spc25 UTSW 2 69204913 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAGTGATACCTAGAGAGATGCTGG -3'
(R):5'- TGTACTTGGAACTGAAGGAGTC -3'

Sequencing Primer
(F):5'- ATACCTAGAGAGATGCTGGTCTGTC -3'
(R):5'- GCCAAAGAATTGTGAGTTTCAGGTC -3'
Posted On2015-04-30