Incidental Mutation 'R3973:Tesk1'
ID 312927
Institutional Source Beutler Lab
Gene Symbol Tesk1
Ensembl Gene ENSMUSG00000028458
Gene Name testis specific protein kinase 1
Synonyms
MMRRC Submission 040841-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.288) question?
Stock # R3973 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 43442277-43448075 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 43445786 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 280 (P280S)
Ref Sequence ENSEMBL: ENSMUSP00000050087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030179] [ENSMUST00000060864] [ENSMUST00000098104] [ENSMUST00000098105] [ENSMUST00000107925] [ENSMUST00000107926] [ENSMUST00000138981]
AlphaFold O70146
Predicted Effect probably benign
Transcript: ENSMUST00000030179
SMART Domains Protein: ENSMUSP00000030179
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
coiled coil region 137 223 N/A INTRINSIC
CLECT 232 348 2.28e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000060864
AA Change: P280S

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000050087
Gene: ENSMUSG00000028458
AA Change: P280S

DomainStartEndE-ValueType
low complexity region 2 33 N/A INTRINSIC
Pfam:Pkinase 52 306 5.4e-46 PFAM
Pfam:Pkinase_Tyr 52 306 3.1e-47 PFAM
low complexity region 316 330 N/A INTRINSIC
low complexity region 345 370 N/A INTRINSIC
low complexity region 403 424 N/A INTRINSIC
low complexity region 472 490 N/A INTRINSIC
low complexity region 513 525 N/A INTRINSIC
low complexity region 549 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098104
SMART Domains Protein: ENSMUSP00000095708
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
coiled coil region 83 169 N/A INTRINSIC
CLECT 178 287 2.48e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098105
SMART Domains Protein: ENSMUSP00000095709
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
coiled coil region 113 199 N/A INTRINSIC
CLECT 208 324 2.28e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107925
SMART Domains Protein: ENSMUSP00000103558
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
coiled coil region 137 223 N/A INTRINSIC
CLECT 232 334 2.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107926
SMART Domains Protein: ENSMUSP00000103559
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
coiled coil region 137 223 N/A INTRINSIC
CLECT 232 341 2.48e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140284
Predicted Effect probably benign
Transcript: ENSMUST00000138981
SMART Domains Protein: ENSMUSP00000121067
Gene: ENSMUSG00000028458

DomainStartEndE-ValueType
low complexity region 2 33 N/A INTRINSIC
Pfam:Pkinase 52 174 7.6e-29 PFAM
Pfam:Pkinase_Tyr 52 175 1.5e-26 PFAM
Meta Mutation Damage Score 0.0961 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a serine/threonine protein kinase that contains an N-terminal protein kinase domain and a C-terminal proline-rich domain. Its protein kinase domain is most closely related to those of the LIM motif-containing protein kinases (LIMKs). The encoded protein can phosphorylate myelin basic protein and histone in vitro. The testicular germ cell-specific expression and developmental pattern of expression of the mouse gene suggests that this gene plays an important role at and after the meiotic phase of spermatogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 148,029,488 (GRCm39) I486T probably damaging Het
4933427D14Rik T C 11: 72,089,567 (GRCm39) R106G probably damaging Het
Cfap54 A G 10: 92,675,333 (GRCm39) S2863P possibly damaging Het
Copa T A 1: 171,948,812 (GRCm39) S1155T probably benign Het
Crot T C 5: 9,027,541 (GRCm39) T264A probably benign Het
Ddx3y G A Y: 1,267,170 (GRCm39) A232V probably damaging Het
Dst T G 1: 34,050,979 (GRCm39) V25G probably benign Het
Ehbp1 C T 11: 22,087,867 (GRCm39) A406T probably benign Het
Eml5 A T 12: 98,768,724 (GRCm39) probably benign Het
Eps8 A T 6: 137,486,153 (GRCm39) M453K probably benign Het
Galnt3 T C 2: 65,937,374 (GRCm39) D112G possibly damaging Het
Glra4 C T X: 135,663,542 (GRCm39) A336T probably damaging Het
Gmppb A G 9: 107,927,338 (GRCm39) D95G probably benign Het
Gprc6a T C 10: 51,504,544 (GRCm39) Y100C possibly damaging Het
Gpx6 C A 13: 21,501,828 (GRCm39) S150Y probably damaging Het
Hsd17b3 A T 13: 64,207,300 (GRCm39) V247D probably damaging Het
Htr7 T C 19: 36,034,160 (GRCm39) D165G probably damaging Het
Igha T C 12: 113,219,972 (GRCm39) probably benign Het
Igsf10 A G 3: 59,239,345 (GRCm39) C279R probably damaging Het
Irak4 A G 15: 94,452,621 (GRCm39) E182G possibly damaging Het
Lipo3 A T 19: 33,535,723 (GRCm39) V274E probably damaging Het
Lrpprc A C 17: 85,078,269 (GRCm39) probably null Het
Mast1 T C 8: 85,645,393 (GRCm39) Y684C probably damaging Het
Mdn1 T C 4: 32,722,363 (GRCm39) F2382L probably benign Het
Mepe C T 5: 104,484,944 (GRCm39) P28L probably benign Het
Mrgpra3 T A 7: 47,239,414 (GRCm39) I171F probably benign Het
Muc2 T A 7: 141,300,541 (GRCm39) probably benign Het
Myh3 C T 11: 66,987,262 (GRCm39) Q1371* probably null Het
Nodal T A 10: 61,258,833 (GRCm39) V90E probably benign Het
Npas4 A T 19: 5,036,579 (GRCm39) H528Q probably benign Het
Nt5dc3 T C 10: 86,660,100 (GRCm39) V382A probably damaging Het
Pcdh18 G A 3: 49,709,035 (GRCm39) T293I probably damaging Het
Phf20l1 A G 15: 66,513,665 (GRCm39) D947G probably damaging Het
Phf8-ps A T 17: 33,285,405 (GRCm39) S466T probably benign Het
Pla2r1 A G 2: 60,279,306 (GRCm39) V758A probably benign Het
Plod2 G T 9: 92,480,672 (GRCm39) G422* probably null Het
Ppp1r12a T C 10: 108,089,341 (GRCm39) V660A probably benign Het
Prdm6 T C 18: 53,673,278 (GRCm39) I186T possibly damaging Het
Prkd3 G A 17: 79,266,570 (GRCm39) probably benign Het
Prrc2a A G 17: 35,376,908 (GRCm39) L734P probably damaging Het
Rnf128 C A X: 138,565,271 (GRCm39) L282I probably damaging Het
Rnf213 A G 11: 119,359,879 (GRCm39) N4424S Het
Scrn3 T C 2: 73,166,121 (GRCm39) S385P possibly damaging Het
Serpina1d A T 12: 103,734,107 (GRCm39) S66T probably benign Het
Setd3 T C 12: 108,131,417 (GRCm39) K3R possibly damaging Het
Slc2a7 A G 4: 150,242,667 (GRCm39) probably null Het
Smad4 G T 18: 73,810,807 (GRCm39) T59K possibly damaging Het
Spc25 A G 2: 69,032,945 (GRCm39) L60P probably damaging Het
Stam A C 2: 14,143,772 (GRCm39) H354P probably damaging Het
Tmem120a C G 5: 135,765,131 (GRCm39) R254P probably benign Het
Traf5 T C 1: 191,729,837 (GRCm39) T405A probably benign Het
Trav7-4 A G 14: 53,699,119 (GRCm39) S89G probably benign Het
Tsc22d1 T C 14: 76,656,049 (GRCm39) S761P probably damaging Het
Ugt1a10 C A 1: 88,143,862 (GRCm39) H361N probably damaging Het
Ugt2b1 C A 5: 87,065,534 (GRCm39) V502L probably benign Het
Vip T A 10: 5,592,590 (GRCm39) S77T possibly damaging Het
Wdr72 A T 9: 74,125,979 (GRCm39) M1025L probably benign Het
Zfp541 A G 7: 15,806,147 (GRCm39) D94G probably damaging Het
Other mutations in Tesk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01755:Tesk1 APN 4 43,445,820 (GRCm39) critical splice donor site probably null
IGL02969:Tesk1 APN 4 43,447,026 (GRCm39) nonsense probably null
IGL02969:Tesk1 APN 4 43,447,027 (GRCm39) missense possibly damaging 0.49
FR4449:Tesk1 UTSW 4 43,447,002 (GRCm39) utr 3 prime probably benign
FR4737:Tesk1 UTSW 4 43,447,004 (GRCm39) frame shift probably null
R0009:Tesk1 UTSW 4 43,445,368 (GRCm39) missense probably damaging 0.99
R0396:Tesk1 UTSW 4 43,446,000 (GRCm39) missense probably damaging 0.99
R0765:Tesk1 UTSW 4 43,446,706 (GRCm39) missense possibly damaging 0.81
R1850:Tesk1 UTSW 4 43,443,576 (GRCm39) missense probably damaging 1.00
R1868:Tesk1 UTSW 4 43,447,201 (GRCm39) missense probably damaging 0.99
R1903:Tesk1 UTSW 4 43,446,998 (GRCm39) missense probably benign 0.00
R3961:Tesk1 UTSW 4 43,445,133 (GRCm39) splice site probably null
R3975:Tesk1 UTSW 4 43,445,786 (GRCm39) missense possibly damaging 0.50
R3976:Tesk1 UTSW 4 43,445,786 (GRCm39) missense possibly damaging 0.50
R4074:Tesk1 UTSW 4 43,443,606 (GRCm39) missense possibly damaging 0.88
R4908:Tesk1 UTSW 4 43,445,555 (GRCm39) nonsense probably null
R5002:Tesk1 UTSW 4 43,444,573 (GRCm39) missense probably damaging 1.00
R5237:Tesk1 UTSW 4 43,447,100 (GRCm39) missense probably damaging 0.98
R6755:Tesk1 UTSW 4 43,445,991 (GRCm39) missense probably benign 0.03
R6886:Tesk1 UTSW 4 43,443,592 (GRCm39) missense possibly damaging 0.72
R6991:Tesk1 UTSW 4 43,447,006 (GRCm39) missense probably benign
R6992:Tesk1 UTSW 4 43,447,006 (GRCm39) missense probably benign
R6993:Tesk1 UTSW 4 43,447,006 (GRCm39) missense probably benign
R7401:Tesk1 UTSW 4 43,445,743 (GRCm39) missense probably damaging 0.99
R7542:Tesk1 UTSW 4 43,445,941 (GRCm39) missense probably benign 0.08
R7825:Tesk1 UTSW 4 43,447,143 (GRCm39) missense probably damaging 0.98
R8795:Tesk1 UTSW 4 43,446,070 (GRCm39) critical splice donor site probably null
R9200:Tesk1 UTSW 4 43,447,307 (GRCm39) missense probably damaging 0.99
R9673:Tesk1 UTSW 4 43,444,574 (GRCm39) missense probably damaging 1.00
X0064:Tesk1 UTSW 4 43,443,534 (GRCm39) missense probably damaging 1.00
Z1177:Tesk1 UTSW 4 43,446,920 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCAGACCCTGACTACCTAC -3'
(R):5'- TGATTTCAGTAAAAGGGGCCCG -3'

Sequencing Primer
(F):5'- CGCACTGAGGTGAGGTAACC -3'
(R):5'- TAAAAGGGGCCCGGGTGC -3'
Posted On 2015-04-30