Incidental Mutation 'R3973:Mepe'
ID 312932
Institutional Source Beutler Lab
Gene Symbol Mepe
Ensembl Gene ENSMUSG00000053863
Gene Name matrix extracellular phosphoglycoprotein with ASARM motif (bone)
Synonyms OF45
MMRRC Submission 040841-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R3973 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 104473195-104486477 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 104484944 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 28 (P28L)
Ref Sequence ENSEMBL: ENSMUSP00000065200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066207]
AlphaFold Q8K4L6
Predicted Effect probably benign
Transcript: ENSMUST00000066207
AA Change: P28L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000065200
Gene: ENSMUSG00000053863
AA Change: P28L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Osteoregulin 29 192 4.2e-76 PFAM
low complexity region 257 272 N/A INTRINSIC
low complexity region 426 438 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted calcium-binding phosphoprotein that belongs to the small integrin-binding ligand, N-linked glycoprotein (SIBLING) family of proteins. Members of this family are components of the extracellular matrix of bone and dentin and regulate bone mineralization. Deficiency of a similar protein in mouse results in increased bone mass. Mice lacking this gene are resistant to aging-related trabecular bone loss. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have increased amounts of trabecular bone in their skeleton and undergo less age related bone loss. Otherwise, they display a normal phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 148,029,488 (GRCm39) I486T probably damaging Het
4933427D14Rik T C 11: 72,089,567 (GRCm39) R106G probably damaging Het
Cfap54 A G 10: 92,675,333 (GRCm39) S2863P possibly damaging Het
Copa T A 1: 171,948,812 (GRCm39) S1155T probably benign Het
Crot T C 5: 9,027,541 (GRCm39) T264A probably benign Het
Ddx3y G A Y: 1,267,170 (GRCm39) A232V probably damaging Het
Dst T G 1: 34,050,979 (GRCm39) V25G probably benign Het
Ehbp1 C T 11: 22,087,867 (GRCm39) A406T probably benign Het
Eml5 A T 12: 98,768,724 (GRCm39) probably benign Het
Eps8 A T 6: 137,486,153 (GRCm39) M453K probably benign Het
Galnt3 T C 2: 65,937,374 (GRCm39) D112G possibly damaging Het
Glra4 C T X: 135,663,542 (GRCm39) A336T probably damaging Het
Gmppb A G 9: 107,927,338 (GRCm39) D95G probably benign Het
Gprc6a T C 10: 51,504,544 (GRCm39) Y100C possibly damaging Het
Gpx6 C A 13: 21,501,828 (GRCm39) S150Y probably damaging Het
Hsd17b3 A T 13: 64,207,300 (GRCm39) V247D probably damaging Het
Htr7 T C 19: 36,034,160 (GRCm39) D165G probably damaging Het
Igha T C 12: 113,219,972 (GRCm39) probably benign Het
Igsf10 A G 3: 59,239,345 (GRCm39) C279R probably damaging Het
Irak4 A G 15: 94,452,621 (GRCm39) E182G possibly damaging Het
Lipo3 A T 19: 33,535,723 (GRCm39) V274E probably damaging Het
Lrpprc A C 17: 85,078,269 (GRCm39) probably null Het
Mast1 T C 8: 85,645,393 (GRCm39) Y684C probably damaging Het
Mdn1 T C 4: 32,722,363 (GRCm39) F2382L probably benign Het
Mrgpra3 T A 7: 47,239,414 (GRCm39) I171F probably benign Het
Muc2 T A 7: 141,300,541 (GRCm39) probably benign Het
Myh3 C T 11: 66,987,262 (GRCm39) Q1371* probably null Het
Nodal T A 10: 61,258,833 (GRCm39) V90E probably benign Het
Npas4 A T 19: 5,036,579 (GRCm39) H528Q probably benign Het
Nt5dc3 T C 10: 86,660,100 (GRCm39) V382A probably damaging Het
Pcdh18 G A 3: 49,709,035 (GRCm39) T293I probably damaging Het
Phf20l1 A G 15: 66,513,665 (GRCm39) D947G probably damaging Het
Phf8-ps A T 17: 33,285,405 (GRCm39) S466T probably benign Het
Pla2r1 A G 2: 60,279,306 (GRCm39) V758A probably benign Het
Plod2 G T 9: 92,480,672 (GRCm39) G422* probably null Het
Ppp1r12a T C 10: 108,089,341 (GRCm39) V660A probably benign Het
Prdm6 T C 18: 53,673,278 (GRCm39) I186T possibly damaging Het
Prkd3 G A 17: 79,266,570 (GRCm39) probably benign Het
Prrc2a A G 17: 35,376,908 (GRCm39) L734P probably damaging Het
Rnf128 C A X: 138,565,271 (GRCm39) L282I probably damaging Het
Rnf213 A G 11: 119,359,879 (GRCm39) N4424S Het
Scrn3 T C 2: 73,166,121 (GRCm39) S385P possibly damaging Het
Serpina1d A T 12: 103,734,107 (GRCm39) S66T probably benign Het
Setd3 T C 12: 108,131,417 (GRCm39) K3R possibly damaging Het
Slc2a7 A G 4: 150,242,667 (GRCm39) probably null Het
Smad4 G T 18: 73,810,807 (GRCm39) T59K possibly damaging Het
Spc25 A G 2: 69,032,945 (GRCm39) L60P probably damaging Het
Stam A C 2: 14,143,772 (GRCm39) H354P probably damaging Het
Tesk1 C T 4: 43,445,786 (GRCm39) P280S possibly damaging Het
Tmem120a C G 5: 135,765,131 (GRCm39) R254P probably benign Het
Traf5 T C 1: 191,729,837 (GRCm39) T405A probably benign Het
Trav7-4 A G 14: 53,699,119 (GRCm39) S89G probably benign Het
Tsc22d1 T C 14: 76,656,049 (GRCm39) S761P probably damaging Het
Ugt1a10 C A 1: 88,143,862 (GRCm39) H361N probably damaging Het
Ugt2b1 C A 5: 87,065,534 (GRCm39) V502L probably benign Het
Vip T A 10: 5,592,590 (GRCm39) S77T possibly damaging Het
Wdr72 A T 9: 74,125,979 (GRCm39) M1025L probably benign Het
Zfp541 A G 7: 15,806,147 (GRCm39) D94G probably damaging Het
Other mutations in Mepe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Mepe APN 5 104,485,843 (GRCm39) missense probably damaging 1.00
IGL01896:Mepe APN 5 104,486,135 (GRCm39) missense possibly damaging 0.85
IGL01997:Mepe APN 5 104,485,466 (GRCm39) missense probably damaging 1.00
IGL02311:Mepe APN 5 104,485,571 (GRCm39) missense probably damaging 0.98
IGL02586:Mepe APN 5 104,485,316 (GRCm39) missense probably benign 0.39
F6893:Mepe UTSW 5 104,485,242 (GRCm39) missense possibly damaging 0.87
R1187:Mepe UTSW 5 104,486,114 (GRCm39) missense probably damaging 0.98
R1218:Mepe UTSW 5 104,474,939 (GRCm39) missense probably benign
R1633:Mepe UTSW 5 104,485,540 (GRCm39) missense probably benign 0.25
R2024:Mepe UTSW 5 104,474,957 (GRCm39) missense possibly damaging 0.72
R2026:Mepe UTSW 5 104,474,957 (GRCm39) missense possibly damaging 0.72
R2027:Mepe UTSW 5 104,474,957 (GRCm39) missense possibly damaging 0.72
R2393:Mepe UTSW 5 104,485,327 (GRCm39) missense possibly damaging 0.95
R2920:Mepe UTSW 5 104,486,113 (GRCm39) missense probably damaging 0.99
R3040:Mepe UTSW 5 104,485,988 (GRCm39) missense probably damaging 0.99
R3716:Mepe UTSW 5 104,485,294 (GRCm39) missense probably benign 0.25
R3976:Mepe UTSW 5 104,484,944 (GRCm39) missense probably benign
R4894:Mepe UTSW 5 104,473,268 (GRCm39) missense probably damaging 0.98
R5556:Mepe UTSW 5 104,486,078 (GRCm39) missense probably damaging 1.00
R6256:Mepe UTSW 5 104,484,940 (GRCm39) missense probably benign 0.01
R6788:Mepe UTSW 5 104,486,074 (GRCm39) nonsense probably null
R7361:Mepe UTSW 5 104,485,009 (GRCm39) missense probably benign 0.41
R8431:Mepe UTSW 5 104,486,047 (GRCm39) missense possibly damaging 0.91
R8679:Mepe UTSW 5 104,485,754 (GRCm39) missense possibly damaging 0.91
R8745:Mepe UTSW 5 104,485,525 (GRCm39) missense possibly damaging 0.93
R8817:Mepe UTSW 5 104,485,151 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TTCCATCCCTATTGAGTTGTAGAC -3'
(R):5'- GACTCTTTACAGGCTGCGTG -3'

Sequencing Primer
(F):5'- CATCCCTATTGAGTTGTAGACTTTAC -3'
(R):5'- TGATATTTCTGAGGAGGGCAGCAC -3'
Posted On 2015-04-30