Mutagenetix > Incidental Mutation

Incidental Mutation 'R3973:Mepe'

312932

Institutional Source

Beutler Lab

Gene Symbol

Mepe

Ensembl Gene

ENSMUSG00000053863

Gene Name

matrix extracellular phosphoglycoprotein with ASARM motif (bone)

Synonyms

OF45

MMRRC Submission

040841-MU

Accession Numbers

Genbank: NM_053172; MGI: 2137384

Is this an essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R3973 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104325329-104338611 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 104337078 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 28 (P28L)

Ref Sequence

ENSEMBL: ENSMUSP00000065200 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066207]

AlphaFold

Q8K4L6

Predicted Effect

probably benign
Transcript: ENSMUST00000066207
AA Change: P28L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000065200
Gene: ENSMUSG00000053863
AA Change: P28L

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Osteoregulin	29	192	4.2e-76	PFAM
low complexity region	257	272	N/A	INTRINSIC
low complexity region	426	438	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.3%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted calcium-binding phosphoprotein that belongs to the small integrin-binding ligand, N-linked glycoprotein (SIBLING) family of proteins. Members of this family are components of the extracellular matrix of bone and dentin and regulate bone mineralization. Deficiency of a similar protein in mouse results in increased bone mass. Mice lacking this gene are resistant to aging-related trabecular bone loss. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have increased amounts of trabecular bone in their skeleton and undergo less age related bone loss. Otherwise, they display a normal phenotype. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	T	C	4: 147,945,031	I486T	probably damaging	Het
4921501E09Rik	A	T	17: 33,066,431	S466T	probably benign	Het
4933427D14Rik	T	C	11: 72,198,741	R106G	probably damaging	Het
Cfap54	A	G	10: 92,839,471	S2863P	possibly damaging	Het
Copa	T	A	1: 172,121,245	S1155T	probably benign	Het
Crot	T	C	5: 8,977,541	T264A	probably benign	Het
Ddx3y	G	A	Y: 1,267,170	A232V	probably damaging	Het
Dst	T	G	1: 34,011,898	V25G	probably benign	Het
Ehbp1	C	T	11: 22,137,867	A406T	probably benign	Het
Eml5	A	T	12: 98,802,465		probably benign	Het
Eps8	A	T	6: 137,509,155	M453K	probably benign	Het
Galnt3	T	C	2: 66,107,030	D112G	possibly damaging	Het
Glra4	C	T	X: 136,762,793	A336T	probably damaging	Het
Gmppb	A	G	9: 108,050,139	D95G	probably benign	Het
Gprc6a	T	C	10: 51,628,448	Y100C	possibly damaging	Het
Gpx6	C	A	13: 21,317,658	S150Y	probably damaging	Het
Hsd17b3	A	T	13: 64,059,486	V247D	probably damaging	Het
Htr7	T	C	19: 36,056,760	D165G	probably damaging	Het
Igha	T	C	12: 113,256,352		probably benign	Het
Igsf10	A	G	3: 59,331,924	C279R	probably damaging	Het
Irak4	A	G	15: 94,554,740	E182G	possibly damaging	Het
Lipo3	A	T	19: 33,558,323	V274E	probably damaging	Het
Lrpprc	A	C	17: 84,770,841		probably null	Het
Mast1	T	C	8: 84,918,764	Y684C	probably damaging	Het
Mdn1	T	C	4: 32,722,363	F2382L	probably benign	Het
Mrgpra3	T	A	7: 47,589,666	I171F	probably benign	Het
Muc2	T	A	7: 141,746,804		probably benign	Het
Myh3	C	T	11: 67,096,436	Q1371*	probably null	Het
Nodal	T	A	10: 61,423,054	V90E	probably benign	Het
Npas4	A	T	19: 4,986,551	H528Q	probably benign	Het
Nt5dc3	T	C	10: 86,824,236	V382A	probably damaging	Het
Pcdh18	G	A	3: 49,754,586	T293I	probably damaging	Het
Phf20l1	A	G	15: 66,641,816	D947G	probably damaging	Het
Pla2r1	A	G	2: 60,448,962	V758A	probably benign	Het
Plod2	G	T	9: 92,598,619	G422*	probably null	Het
Ppp1r12a	T	C	10: 108,253,480	V660A	probably benign	Het
Prdm6	T	C	18: 53,540,206	I186T	possibly damaging	Het
Prkd3	G	A	17: 78,959,141		probably benign	Het
Prrc2a	A	G	17: 35,157,932	L734P	probably damaging	Het
Rnf128	C	A	X: 139,664,522	L282I	probably damaging	Het
Rnf213	A	G	11: 119,469,053	N4424S		Het
Scrn3	T	C	2: 73,335,777	S385P	possibly damaging	Het
Serpina1d	A	T	12: 103,767,848	S66T	probably benign	Het
Setd3	T	C	12: 108,165,158	K3R	possibly damaging	Het
Slc2a7	A	G	4: 150,158,210		probably null	Het
Smad4	G	T	18: 73,677,736	T59K	possibly damaging	Het
Spc25	A	G	2: 69,202,601	L60P	probably damaging	Het
Stam	A	C	2: 14,138,961	H354P	probably damaging	Het
Tesk1	C	T	4: 43,445,786	P280S	possibly damaging	Het
Tmem120a	C	G	5: 135,736,277	R254P	probably benign	Het
Traf5	T	C	1: 191,997,876	T405A	probably benign	Het
Trav7-4	A	G	14: 53,461,662	S89G	probably benign	Het
Tsc22d1	T	C	14: 76,418,609	S761P	probably damaging	Het
Ugt1a10	C	A	1: 88,216,140	H361N	probably damaging	Het
Ugt2b1	C	A	5: 86,917,675	V502L	probably benign	Het
Vip	T	A	10: 5,642,590	S77T	possibly damaging	Het
Wdr72	A	T	9: 74,218,697	M1025L	probably benign	Het
Zfp541	A	G	7: 16,072,222	D94G	probably damaging	Het

Other mutations in Mepe

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00335:Mepe	APN	5	104337977	missense	probably damaging	1.00
IGL01896:Mepe	APN	5	104338269	missense	possibly damaging	0.85
IGL01997:Mepe	APN	5	104337600	missense	probably damaging	1.00
IGL02311:Mepe	APN	5	104337705	missense	probably damaging	0.98
IGL02586:Mepe	APN	5	104337450	missense	probably benign	0.39
F6893:Mepe	UTSW	5	104337376	missense	possibly damaging	0.87
R1187:Mepe	UTSW	5	104338248	missense	probably damaging	0.98
R1218:Mepe	UTSW	5	104327073	missense	probably benign
R1633:Mepe	UTSW	5	104337674	missense	probably benign	0.25
R2024:Mepe	UTSW	5	104327091	missense	possibly damaging	0.72
R2026:Mepe	UTSW	5	104327091	missense	possibly damaging	0.72
R2027:Mepe	UTSW	5	104327091	missense	possibly damaging	0.72
R2393:Mepe	UTSW	5	104337461	missense	possibly damaging	0.95
R2920:Mepe	UTSW	5	104338247	missense	probably damaging	0.99
R3040:Mepe	UTSW	5	104338122	missense	probably damaging	0.99
R3716:Mepe	UTSW	5	104337428	missense	probably benign	0.25
R3976:Mepe	UTSW	5	104337078	missense	probably benign
R4894:Mepe	UTSW	5	104325402	missense	probably damaging	0.98
R5556:Mepe	UTSW	5	104338212	missense	probably damaging	1.00
R6256:Mepe	UTSW	5	104337074	missense	probably benign	0.01
R6788:Mepe	UTSW	5	104338208	nonsense	probably null
R7361:Mepe	UTSW	5	104337143	missense	probably benign	0.41
R8431:Mepe	UTSW	5	104338181	missense	possibly damaging	0.91
R8679:Mepe	UTSW	5	104337888	missense	possibly damaging	0.91
R8745:Mepe	UTSW	5	104337659	missense	possibly damaging	0.93
R8817:Mepe	UTSW	5	104337285	missense	probably benign	0.12

Predicted Primers

PCR Primer
(F):5'- TTCCATCCCTATTGAGTTGTAGAC -3'
(R):5'- GACTCTTTACAGGCTGCGTG -3'

Sequencing Primer
(F):5'- CATCCCTATTGAGTTGTAGACTTTAC -3'
(R):5'- TGATATTTCTGAGGAGGGCAGCAC -3'

Posted On

2015-04-30