Incidental Mutation 'R3973:Zfp541'
ID 312935
Institutional Source Beutler Lab
Gene Symbol Zfp541
Ensembl Gene ENSMUSG00000078796
Gene Name zinc finger protein 541
Synonyms EG666528
MMRRC Submission 040841-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.750) question?
Stock # R3973 (G1)
Quality Score 160
Status Validated
Chromosome 7
Chromosomal Location 15795739-15830259 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 15806147 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 94 (D94G)
Ref Sequence ENSEMBL: ENSMUSP00000148143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108509] [ENSMUST00000209369] [ENSMUST00000210805]
AlphaFold Q0GGX2
Predicted Effect probably damaging
Transcript: ENSMUST00000108509
AA Change: D94G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104149
Gene: ENSMUSG00000078796
AA Change: D94G

DomainStartEndE-ValueType
low complexity region 48 65 N/A INTRINSIC
ZnF_C2H2 140 162 2.24e-3 SMART
ZnF_C2H2 168 190 4.47e-3 SMART
ZnF_C2H2 196 221 2.36e-2 SMART
low complexity region 249 260 N/A INTRINSIC
low complexity region 362 374 N/A INTRINSIC
low complexity region 444 465 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 594 609 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
ZnF_C2H2 838 860 3.72e0 SMART
low complexity region 953 958 N/A INTRINSIC
ELM2 1065 1122 4.46e-14 SMART
SANT 1171 1219 8.38e-7 SMART
low complexity region 1252 1263 N/A INTRINSIC
ZnF_C2H2 1301 1323 1.01e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209369
AA Change: D94G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000210805
AA Change: D94G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1331 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 148,029,488 (GRCm39) I486T probably damaging Het
4933427D14Rik T C 11: 72,089,567 (GRCm39) R106G probably damaging Het
Cfap54 A G 10: 92,675,333 (GRCm39) S2863P possibly damaging Het
Copa T A 1: 171,948,812 (GRCm39) S1155T probably benign Het
Crot T C 5: 9,027,541 (GRCm39) T264A probably benign Het
Ddx3y G A Y: 1,267,170 (GRCm39) A232V probably damaging Het
Dst T G 1: 34,050,979 (GRCm39) V25G probably benign Het
Ehbp1 C T 11: 22,087,867 (GRCm39) A406T probably benign Het
Eml5 A T 12: 98,768,724 (GRCm39) probably benign Het
Eps8 A T 6: 137,486,153 (GRCm39) M453K probably benign Het
Galnt3 T C 2: 65,937,374 (GRCm39) D112G possibly damaging Het
Glra4 C T X: 135,663,542 (GRCm39) A336T probably damaging Het
Gmppb A G 9: 107,927,338 (GRCm39) D95G probably benign Het
Gprc6a T C 10: 51,504,544 (GRCm39) Y100C possibly damaging Het
Gpx6 C A 13: 21,501,828 (GRCm39) S150Y probably damaging Het
Hsd17b3 A T 13: 64,207,300 (GRCm39) V247D probably damaging Het
Htr7 T C 19: 36,034,160 (GRCm39) D165G probably damaging Het
Igha T C 12: 113,219,972 (GRCm39) probably benign Het
Igsf10 A G 3: 59,239,345 (GRCm39) C279R probably damaging Het
Irak4 A G 15: 94,452,621 (GRCm39) E182G possibly damaging Het
Lipo3 A T 19: 33,535,723 (GRCm39) V274E probably damaging Het
Lrpprc A C 17: 85,078,269 (GRCm39) probably null Het
Mast1 T C 8: 85,645,393 (GRCm39) Y684C probably damaging Het
Mdn1 T C 4: 32,722,363 (GRCm39) F2382L probably benign Het
Mepe C T 5: 104,484,944 (GRCm39) P28L probably benign Het
Mrgpra3 T A 7: 47,239,414 (GRCm39) I171F probably benign Het
Muc2 T A 7: 141,300,541 (GRCm39) probably benign Het
Myh3 C T 11: 66,987,262 (GRCm39) Q1371* probably null Het
Nodal T A 10: 61,258,833 (GRCm39) V90E probably benign Het
Npas4 A T 19: 5,036,579 (GRCm39) H528Q probably benign Het
Nt5dc3 T C 10: 86,660,100 (GRCm39) V382A probably damaging Het
Pcdh18 G A 3: 49,709,035 (GRCm39) T293I probably damaging Het
Phf20l1 A G 15: 66,513,665 (GRCm39) D947G probably damaging Het
Phf8-ps A T 17: 33,285,405 (GRCm39) S466T probably benign Het
Pla2r1 A G 2: 60,279,306 (GRCm39) V758A probably benign Het
Plod2 G T 9: 92,480,672 (GRCm39) G422* probably null Het
Ppp1r12a T C 10: 108,089,341 (GRCm39) V660A probably benign Het
Prdm6 T C 18: 53,673,278 (GRCm39) I186T possibly damaging Het
Prkd3 G A 17: 79,266,570 (GRCm39) probably benign Het
Prrc2a A G 17: 35,376,908 (GRCm39) L734P probably damaging Het
Rnf128 C A X: 138,565,271 (GRCm39) L282I probably damaging Het
Rnf213 A G 11: 119,359,879 (GRCm39) N4424S Het
Scrn3 T C 2: 73,166,121 (GRCm39) S385P possibly damaging Het
Serpina1d A T 12: 103,734,107 (GRCm39) S66T probably benign Het
Setd3 T C 12: 108,131,417 (GRCm39) K3R possibly damaging Het
Slc2a7 A G 4: 150,242,667 (GRCm39) probably null Het
Smad4 G T 18: 73,810,807 (GRCm39) T59K possibly damaging Het
Spc25 A G 2: 69,032,945 (GRCm39) L60P probably damaging Het
Stam A C 2: 14,143,772 (GRCm39) H354P probably damaging Het
Tesk1 C T 4: 43,445,786 (GRCm39) P280S possibly damaging Het
Tmem120a C G 5: 135,765,131 (GRCm39) R254P probably benign Het
Traf5 T C 1: 191,729,837 (GRCm39) T405A probably benign Het
Trav7-4 A G 14: 53,699,119 (GRCm39) S89G probably benign Het
Tsc22d1 T C 14: 76,656,049 (GRCm39) S761P probably damaging Het
Ugt1a10 C A 1: 88,143,862 (GRCm39) H361N probably damaging Het
Ugt2b1 C A 5: 87,065,534 (GRCm39) V502L probably benign Het
Vip T A 10: 5,592,590 (GRCm39) S77T possibly damaging Het
Wdr72 A T 9: 74,125,979 (GRCm39) M1025L probably benign Het
Other mutations in Zfp541
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02162:Zfp541 APN 7 15,813,393 (GRCm39) missense possibly damaging 0.80
IGL02262:Zfp541 APN 7 15,813,620 (GRCm39) missense probably damaging 1.00
IGL02347:Zfp541 APN 7 15,817,390 (GRCm39) missense probably damaging 1.00
IGL02516:Zfp541 APN 7 15,816,918 (GRCm39) splice site probably null
R0101:Zfp541 UTSW 7 15,811,968 (GRCm39) missense probably damaging 1.00
R0412:Zfp541 UTSW 7 15,816,099 (GRCm39) missense possibly damaging 0.88
R0627:Zfp541 UTSW 7 15,829,607 (GRCm39) splice site probably benign
R0784:Zfp541 UTSW 7 15,816,917 (GRCm39) intron probably benign
R1083:Zfp541 UTSW 7 15,812,637 (GRCm39) missense probably benign 0.16
R1541:Zfp541 UTSW 7 15,812,437 (GRCm39) missense probably benign 0.04
R1575:Zfp541 UTSW 7 15,812,640 (GRCm39) missense possibly damaging 0.94
R1730:Zfp541 UTSW 7 15,811,898 (GRCm39) missense probably damaging 0.99
R1783:Zfp541 UTSW 7 15,811,898 (GRCm39) missense probably damaging 0.99
R1966:Zfp541 UTSW 7 15,812,996 (GRCm39) missense probably benign 0.02
R2022:Zfp541 UTSW 7 15,816,110 (GRCm39) missense probably damaging 1.00
R2048:Zfp541 UTSW 7 15,812,252 (GRCm39) missense possibly damaging 0.94
R2436:Zfp541 UTSW 7 15,810,373 (GRCm39) missense possibly damaging 0.94
R4081:Zfp541 UTSW 7 15,806,060 (GRCm39) missense probably benign 0.16
R4589:Zfp541 UTSW 7 15,817,261 (GRCm39) missense probably benign 0.35
R4724:Zfp541 UTSW 7 15,815,612 (GRCm39) missense probably damaging 0.99
R4812:Zfp541 UTSW 7 15,813,035 (GRCm39) missense probably benign 0.01
R4817:Zfp541 UTSW 7 15,824,307 (GRCm39) missense probably damaging 1.00
R5232:Zfp541 UTSW 7 15,829,104 (GRCm39) missense probably damaging 1.00
R5331:Zfp541 UTSW 7 15,829,683 (GRCm39) missense probably damaging 1.00
R5551:Zfp541 UTSW 7 15,824,786 (GRCm39) missense probably damaging 1.00
R5976:Zfp541 UTSW 7 15,810,344 (GRCm39) missense probably benign 0.34
R6259:Zfp541 UTSW 7 15,829,451 (GRCm39) missense probably benign 0.02
R6523:Zfp541 UTSW 7 15,829,445 (GRCm39) missense probably damaging 1.00
R6826:Zfp541 UTSW 7 15,812,907 (GRCm39) missense probably damaging 0.96
R7319:Zfp541 UTSW 7 15,813,294 (GRCm39) missense probably benign 0.21
R7428:Zfp541 UTSW 7 15,826,793 (GRCm39) missense probably damaging 1.00
R7594:Zfp541 UTSW 7 15,810,311 (GRCm39) missense probably damaging 0.96
R7724:Zfp541 UTSW 7 15,805,919 (GRCm39) missense probably damaging 1.00
R8276:Zfp541 UTSW 7 15,813,009 (GRCm39) missense possibly damaging 0.87
R8433:Zfp541 UTSW 7 15,805,999 (GRCm39) missense probably benign 0.16
R9068:Zfp541 UTSW 7 15,812,376 (GRCm39) missense probably damaging 0.96
R9086:Zfp541 UTSW 7 15,824,329 (GRCm39) missense probably damaging 1.00
R9132:Zfp541 UTSW 7 15,816,966 (GRCm39) missense probably benign 0.45
R9261:Zfp541 UTSW 7 15,816,029 (GRCm39) missense possibly damaging 0.94
R9408:Zfp541 UTSW 7 15,806,139 (GRCm39) missense probably damaging 1.00
R9518:Zfp541 UTSW 7 15,813,036 (GRCm39) missense possibly damaging 0.80
R9621:Zfp541 UTSW 7 15,805,892 (GRCm39) missense possibly damaging 0.94
Z1088:Zfp541 UTSW 7 15,813,720 (GRCm39) missense probably benign 0.16
Z1176:Zfp541 UTSW 7 15,812,191 (GRCm39) missense probably damaging 1.00
Z1177:Zfp541 UTSW 7 15,816,092 (GRCm39) missense probably damaging 0.98
Z1177:Zfp541 UTSW 7 15,812,954 (GRCm39) missense probably benign 0.26
Z1177:Zfp541 UTSW 7 15,812,688 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGTGACACACTCAACCG -3'
(R):5'- TAGGATAAAAGCCTCCTCTACAAG -3'

Sequencing Primer
(F):5'- ACACTCAACCGGGACCTGG -3'
(R):5'- AAGTCAGGGTCTTACTATGTAGCTC -3'
Posted On 2015-04-30