Incidental Mutation 'R3973:Vip'
ID 312941
Institutional Source Beutler Lab
Gene Symbol Vip
Ensembl Gene ENSMUSG00000019772
Gene Name vasoactive intestinal polypeptide
Synonyms PHI, peptide histidine isoleucine
MMRRC Submission 040841-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.199) question?
Stock # R3973 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 5589218-5597617 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 5592590 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 77 (S77T)
Ref Sequence ENSEMBL: ENSMUSP00000019906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019906]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000019906
AA Change: S77T

PolyPhen 2 Score 0.570 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000019906
Gene: ENSMUSG00000019772
AA Change: S77T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
GLUCA 82 108 2.87e-11 SMART
GLUCA 126 152 6.39e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217331
Meta Mutation Damage Score 0.0615 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: This gene encodes a neuropeptide of the glucagon/secretin superfamily with potent bronchodilator, immunomodulator and anti-inflammatory properties. The encoded protein is proteolytically processed to generate two structurally similar neuropeptides - vasoactive intestinal peptide (VIP) and peptide histidine isoleucine (PHI). In the digestive tract, VIP stimulates relaxation of enteric smooth muscle, secretion of water and electrolytes, release of insulin and glucagon, and inhibition of gastric acid secretion. In the cardiovascular system, VIP causes coronary vasodilation and stimulates contractility in the heart. Mice lacking VIP exhibit airway hyperresponsiveness and airway inflammation. Male mice lacking VIP exhibit moderate pulmonary arterial hypertension resulting in increased mortality. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants display abnormal circadian rhythyms with a shorter period, abnormal phase, and in 1/4 arrhythmic circadian persistence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 148,029,488 (GRCm39) I486T probably damaging Het
4933427D14Rik T C 11: 72,089,567 (GRCm39) R106G probably damaging Het
Cfap54 A G 10: 92,675,333 (GRCm39) S2863P possibly damaging Het
Copa T A 1: 171,948,812 (GRCm39) S1155T probably benign Het
Crot T C 5: 9,027,541 (GRCm39) T264A probably benign Het
Ddx3y G A Y: 1,267,170 (GRCm39) A232V probably damaging Het
Dst T G 1: 34,050,979 (GRCm39) V25G probably benign Het
Ehbp1 C T 11: 22,087,867 (GRCm39) A406T probably benign Het
Eml5 A T 12: 98,768,724 (GRCm39) probably benign Het
Eps8 A T 6: 137,486,153 (GRCm39) M453K probably benign Het
Galnt3 T C 2: 65,937,374 (GRCm39) D112G possibly damaging Het
Glra4 C T X: 135,663,542 (GRCm39) A336T probably damaging Het
Gmppb A G 9: 107,927,338 (GRCm39) D95G probably benign Het
Gprc6a T C 10: 51,504,544 (GRCm39) Y100C possibly damaging Het
Gpx6 C A 13: 21,501,828 (GRCm39) S150Y probably damaging Het
Hsd17b3 A T 13: 64,207,300 (GRCm39) V247D probably damaging Het
Htr7 T C 19: 36,034,160 (GRCm39) D165G probably damaging Het
Igha T C 12: 113,219,972 (GRCm39) probably benign Het
Igsf10 A G 3: 59,239,345 (GRCm39) C279R probably damaging Het
Irak4 A G 15: 94,452,621 (GRCm39) E182G possibly damaging Het
Lipo3 A T 19: 33,535,723 (GRCm39) V274E probably damaging Het
Lrpprc A C 17: 85,078,269 (GRCm39) probably null Het
Mast1 T C 8: 85,645,393 (GRCm39) Y684C probably damaging Het
Mdn1 T C 4: 32,722,363 (GRCm39) F2382L probably benign Het
Mepe C T 5: 104,484,944 (GRCm39) P28L probably benign Het
Mrgpra3 T A 7: 47,239,414 (GRCm39) I171F probably benign Het
Muc2 T A 7: 141,300,541 (GRCm39) probably benign Het
Myh3 C T 11: 66,987,262 (GRCm39) Q1371* probably null Het
Nodal T A 10: 61,258,833 (GRCm39) V90E probably benign Het
Npas4 A T 19: 5,036,579 (GRCm39) H528Q probably benign Het
Nt5dc3 T C 10: 86,660,100 (GRCm39) V382A probably damaging Het
Pcdh18 G A 3: 49,709,035 (GRCm39) T293I probably damaging Het
Phf20l1 A G 15: 66,513,665 (GRCm39) D947G probably damaging Het
Phf8-ps A T 17: 33,285,405 (GRCm39) S466T probably benign Het
Pla2r1 A G 2: 60,279,306 (GRCm39) V758A probably benign Het
Plod2 G T 9: 92,480,672 (GRCm39) G422* probably null Het
Ppp1r12a T C 10: 108,089,341 (GRCm39) V660A probably benign Het
Prdm6 T C 18: 53,673,278 (GRCm39) I186T possibly damaging Het
Prkd3 G A 17: 79,266,570 (GRCm39) probably benign Het
Prrc2a A G 17: 35,376,908 (GRCm39) L734P probably damaging Het
Rnf128 C A X: 138,565,271 (GRCm39) L282I probably damaging Het
Rnf213 A G 11: 119,359,879 (GRCm39) N4424S Het
Scrn3 T C 2: 73,166,121 (GRCm39) S385P possibly damaging Het
Serpina1d A T 12: 103,734,107 (GRCm39) S66T probably benign Het
Setd3 T C 12: 108,131,417 (GRCm39) K3R possibly damaging Het
Slc2a7 A G 4: 150,242,667 (GRCm39) probably null Het
Smad4 G T 18: 73,810,807 (GRCm39) T59K possibly damaging Het
Spc25 A G 2: 69,032,945 (GRCm39) L60P probably damaging Het
Stam A C 2: 14,143,772 (GRCm39) H354P probably damaging Het
Tesk1 C T 4: 43,445,786 (GRCm39) P280S possibly damaging Het
Tmem120a C G 5: 135,765,131 (GRCm39) R254P probably benign Het
Traf5 T C 1: 191,729,837 (GRCm39) T405A probably benign Het
Trav7-4 A G 14: 53,699,119 (GRCm39) S89G probably benign Het
Tsc22d1 T C 14: 76,656,049 (GRCm39) S761P probably damaging Het
Ugt1a10 C A 1: 88,143,862 (GRCm39) H361N probably damaging Het
Ugt2b1 C A 5: 87,065,534 (GRCm39) V502L probably benign Het
Wdr72 A T 9: 74,125,979 (GRCm39) M1025L probably benign Het
Zfp541 A G 7: 15,806,147 (GRCm39) D94G probably damaging Het
Other mutations in Vip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Vip APN 10 5,592,480 (GRCm39) missense probably benign 0.28
IGL02182:Vip APN 10 5,593,561 (GRCm39) missense probably benign 0.01
R0082:Vip UTSW 10 5,594,953 (GRCm39) makesense probably null
R0267:Vip UTSW 10 5,594,004 (GRCm39) missense possibly damaging 0.67
R1776:Vip UTSW 10 5,594,992 (GRCm39) critical splice donor site probably null
R4803:Vip UTSW 10 5,594,099 (GRCm39) missense probably damaging 0.99
R5898:Vip UTSW 10 5,593,988 (GRCm39) missense probably damaging 0.96
R6365:Vip UTSW 10 5,594,021 (GRCm39) nonsense probably null
R9571:Vip UTSW 10 5,590,661 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCTGGTTTCAAGTAGTTGCCAG -3'
(R):5'- CTGGGCTTTGTGTAATAATCTGAGC -3'

Sequencing Primer
(F):5'- TCAAGTAGTTGCCAGACCATAAATAC -3'
(R):5'- TGTGTAATAATCTGAGCATGATGC -3'
Posted On 2015-04-30