Incidental Mutation 'R3973:Nt5dc3'
ID 312945
Institutional Source Beutler Lab
Gene Symbol Nt5dc3
Ensembl Gene ENSMUSG00000054027
Gene Name 5'-nucleotidase domain containing 3
Synonyms Gnn, C630002B14Rik
MMRRC Submission 040841-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3973 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 86614869-86674253 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86660100 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 382 (V382A)
Ref Sequence ENSEMBL: ENSMUSP00000096994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099396]
AlphaFold Q3UHB1
Predicted Effect probably damaging
Transcript: ENSMUST00000099396
AA Change: V382A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096994
Gene: ENSMUSG00000054027
AA Change: V382A

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:5_nucleotid 83 526 1.8e-159 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218792
Predicted Effect unknown
Transcript: ENSMUST00000218802
AA Change: V323A
Meta Mutation Damage Score 0.6253 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 148,029,488 (GRCm39) I486T probably damaging Het
4933427D14Rik T C 11: 72,089,567 (GRCm39) R106G probably damaging Het
Cfap54 A G 10: 92,675,333 (GRCm39) S2863P possibly damaging Het
Copa T A 1: 171,948,812 (GRCm39) S1155T probably benign Het
Crot T C 5: 9,027,541 (GRCm39) T264A probably benign Het
Ddx3y G A Y: 1,267,170 (GRCm39) A232V probably damaging Het
Dst T G 1: 34,050,979 (GRCm39) V25G probably benign Het
Ehbp1 C T 11: 22,087,867 (GRCm39) A406T probably benign Het
Eml5 A T 12: 98,768,724 (GRCm39) probably benign Het
Eps8 A T 6: 137,486,153 (GRCm39) M453K probably benign Het
Galnt3 T C 2: 65,937,374 (GRCm39) D112G possibly damaging Het
Glra4 C T X: 135,663,542 (GRCm39) A336T probably damaging Het
Gmppb A G 9: 107,927,338 (GRCm39) D95G probably benign Het
Gprc6a T C 10: 51,504,544 (GRCm39) Y100C possibly damaging Het
Gpx6 C A 13: 21,501,828 (GRCm39) S150Y probably damaging Het
Hsd17b3 A T 13: 64,207,300 (GRCm39) V247D probably damaging Het
Htr7 T C 19: 36,034,160 (GRCm39) D165G probably damaging Het
Igha T C 12: 113,219,972 (GRCm39) probably benign Het
Igsf10 A G 3: 59,239,345 (GRCm39) C279R probably damaging Het
Irak4 A G 15: 94,452,621 (GRCm39) E182G possibly damaging Het
Lipo3 A T 19: 33,535,723 (GRCm39) V274E probably damaging Het
Lrpprc A C 17: 85,078,269 (GRCm39) probably null Het
Mast1 T C 8: 85,645,393 (GRCm39) Y684C probably damaging Het
Mdn1 T C 4: 32,722,363 (GRCm39) F2382L probably benign Het
Mepe C T 5: 104,484,944 (GRCm39) P28L probably benign Het
Mrgpra3 T A 7: 47,239,414 (GRCm39) I171F probably benign Het
Muc2 T A 7: 141,300,541 (GRCm39) probably benign Het
Myh3 C T 11: 66,987,262 (GRCm39) Q1371* probably null Het
Nodal T A 10: 61,258,833 (GRCm39) V90E probably benign Het
Npas4 A T 19: 5,036,579 (GRCm39) H528Q probably benign Het
Pcdh18 G A 3: 49,709,035 (GRCm39) T293I probably damaging Het
Phf20l1 A G 15: 66,513,665 (GRCm39) D947G probably damaging Het
Phf8-ps A T 17: 33,285,405 (GRCm39) S466T probably benign Het
Pla2r1 A G 2: 60,279,306 (GRCm39) V758A probably benign Het
Plod2 G T 9: 92,480,672 (GRCm39) G422* probably null Het
Ppp1r12a T C 10: 108,089,341 (GRCm39) V660A probably benign Het
Prdm6 T C 18: 53,673,278 (GRCm39) I186T possibly damaging Het
Prkd3 G A 17: 79,266,570 (GRCm39) probably benign Het
Prrc2a A G 17: 35,376,908 (GRCm39) L734P probably damaging Het
Rnf128 C A X: 138,565,271 (GRCm39) L282I probably damaging Het
Rnf213 A G 11: 119,359,879 (GRCm39) N4424S Het
Scrn3 T C 2: 73,166,121 (GRCm39) S385P possibly damaging Het
Serpina1d A T 12: 103,734,107 (GRCm39) S66T probably benign Het
Setd3 T C 12: 108,131,417 (GRCm39) K3R possibly damaging Het
Slc2a7 A G 4: 150,242,667 (GRCm39) probably null Het
Smad4 G T 18: 73,810,807 (GRCm39) T59K possibly damaging Het
Spc25 A G 2: 69,032,945 (GRCm39) L60P probably damaging Het
Stam A C 2: 14,143,772 (GRCm39) H354P probably damaging Het
Tesk1 C T 4: 43,445,786 (GRCm39) P280S possibly damaging Het
Tmem120a C G 5: 135,765,131 (GRCm39) R254P probably benign Het
Traf5 T C 1: 191,729,837 (GRCm39) T405A probably benign Het
Trav7-4 A G 14: 53,699,119 (GRCm39) S89G probably benign Het
Tsc22d1 T C 14: 76,656,049 (GRCm39) S761P probably damaging Het
Ugt1a10 C A 1: 88,143,862 (GRCm39) H361N probably damaging Het
Ugt2b1 C A 5: 87,065,534 (GRCm39) V502L probably benign Het
Vip T A 10: 5,592,590 (GRCm39) S77T possibly damaging Het
Wdr72 A T 9: 74,125,979 (GRCm39) M1025L probably benign Het
Zfp541 A G 7: 15,806,147 (GRCm39) D94G probably damaging Het
Other mutations in Nt5dc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Nt5dc3 APN 10 86,669,838 (GRCm39) splice site probably null
IGL00767:Nt5dc3 APN 10 86,656,137 (GRCm39) splice site probably benign
IGL01318:Nt5dc3 APN 10 86,661,089 (GRCm39) missense possibly damaging 0.69
IGL01369:Nt5dc3 APN 10 86,656,139 (GRCm39) splice site probably benign
IGL01376:Nt5dc3 APN 10 86,670,028 (GRCm39) missense probably benign 0.05
IGL01568:Nt5dc3 APN 10 86,669,802 (GRCm39) missense probably benign 0.02
IGL02286:Nt5dc3 APN 10 86,656,644 (GRCm39) splice site probably benign
IGL02692:Nt5dc3 APN 10 86,640,642 (GRCm39) splice site probably null
R0372:Nt5dc3 UTSW 10 86,661,155 (GRCm39) missense possibly damaging 0.82
R0714:Nt5dc3 UTSW 10 86,648,238 (GRCm39) missense probably damaging 1.00
R1755:Nt5dc3 UTSW 10 86,660,115 (GRCm39) missense probably damaging 1.00
R1888:Nt5dc3 UTSW 10 86,669,926 (GRCm39) missense possibly damaging 0.66
R1888:Nt5dc3 UTSW 10 86,669,926 (GRCm39) missense possibly damaging 0.66
R4097:Nt5dc3 UTSW 10 86,669,820 (GRCm39) missense probably benign 0.01
R4871:Nt5dc3 UTSW 10 86,652,941 (GRCm39) missense probably damaging 1.00
R5286:Nt5dc3 UTSW 10 86,640,656 (GRCm39) missense probably benign 0.08
R5482:Nt5dc3 UTSW 10 86,647,395 (GRCm39) missense probably damaging 1.00
R5530:Nt5dc3 UTSW 10 86,656,857 (GRCm39) missense probably damaging 0.99
R5861:Nt5dc3 UTSW 10 86,651,738 (GRCm39) missense probably damaging 1.00
R6260:Nt5dc3 UTSW 10 86,647,395 (GRCm39) missense probably damaging 1.00
R8251:Nt5dc3 UTSW 10 86,656,091 (GRCm39) missense probably damaging 0.98
R8734:Nt5dc3 UTSW 10 86,669,863 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTTCCAAGAGTGTGCTTTTAGC -3'
(R):5'- GCATTTAGCGTATCATAGTGCTTTC -3'

Sequencing Primer
(F):5'- CAAGAGTGTGCTTTTAGCTTTATTTG -3'
(R):5'- GCGTATCATAGTGCTTTCAATAGTTC -3'
Posted On 2015-04-30