Incidental Mutation 'R3973:Cfap54'
ID 312946
Institutional Source Beutler Lab
Gene Symbol Cfap54
Ensembl Gene ENSMUSG00000020014
Gene Name cilia and flagella associated protein 54
Synonyms LOC380653, Gm872, 4930485B16Rik
MMRRC Submission 040841-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.095) question?
Stock # R3973 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 92775619-93081618 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 92839471 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 2863 (S2863P)
Ref Sequence ENSEMBL: ENSMUSP00000148636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168110] [ENSMUST00000212902]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000163209
Predicted Effect unknown
Transcript: ENSMUST00000168110
AA Change: S2798P
SMART Domains Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: S2798P

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 104 642 1.1e-269 PFAM
low complexity region 842 851 N/A INTRINSIC
low complexity region 902 915 N/A INTRINSIC
Blast:FN3 916 1002 4e-48 BLAST
low complexity region 1409 1426 N/A INTRINSIC
low complexity region 1974 1984 N/A INTRINSIC
low complexity region 2354 2370 N/A INTRINSIC
low complexity region 2500 2513 N/A INTRINSIC
low complexity region 2605 2616 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000212902
AA Change: S2863P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (61/62)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,031 I486T probably damaging Het
4921501E09Rik A T 17: 33,066,431 S466T probably benign Het
4933427D14Rik T C 11: 72,198,741 R106G probably damaging Het
Copa T A 1: 172,121,245 S1155T probably benign Het
Crot T C 5: 8,977,541 T264A probably benign Het
Ddx3y G A Y: 1,267,170 A232V probably damaging Het
Dst T G 1: 34,011,898 V25G probably benign Het
Ehbp1 C T 11: 22,137,867 A406T probably benign Het
Eml5 A T 12: 98,802,465 probably benign Het
Eps8 A T 6: 137,509,155 M453K probably benign Het
Galnt3 T C 2: 66,107,030 D112G possibly damaging Het
Glra4 C T X: 136,762,793 A336T probably damaging Het
Gmppb A G 9: 108,050,139 D95G probably benign Het
Gprc6a T C 10: 51,628,448 Y100C possibly damaging Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Hsd17b3 A T 13: 64,059,486 V247D probably damaging Het
Htr7 T C 19: 36,056,760 D165G probably damaging Het
Igha T C 12: 113,256,352 probably benign Het
Igsf10 A G 3: 59,331,924 C279R probably damaging Het
Irak4 A G 15: 94,554,740 E182G possibly damaging Het
Lipo3 A T 19: 33,558,323 V274E probably damaging Het
Lrpprc A C 17: 84,770,841 probably null Het
Mast1 T C 8: 84,918,764 Y684C probably damaging Het
Mdn1 T C 4: 32,722,363 F2382L probably benign Het
Mepe C T 5: 104,337,078 P28L probably benign Het
Mrgpra3 T A 7: 47,589,666 I171F probably benign Het
Muc2 T A 7: 141,746,804 probably benign Het
Myh3 C T 11: 67,096,436 Q1371* probably null Het
Nodal T A 10: 61,423,054 V90E probably benign Het
Npas4 A T 19: 4,986,551 H528Q probably benign Het
Nt5dc3 T C 10: 86,824,236 V382A probably damaging Het
Pcdh18 G A 3: 49,754,586 T293I probably damaging Het
Phf20l1 A G 15: 66,641,816 D947G probably damaging Het
Pla2r1 A G 2: 60,448,962 V758A probably benign Het
Plod2 G T 9: 92,598,619 G422* probably null Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Prkd3 G A 17: 78,959,141 probably benign Het
Prrc2a A G 17: 35,157,932 L734P probably damaging Het
Rnf128 C A X: 139,664,522 L282I probably damaging Het
Rnf213 A G 11: 119,469,053 N4424S Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Serpina1d A T 12: 103,767,848 S66T probably benign Het
Setd3 T C 12: 108,165,158 K3R possibly damaging Het
Slc2a7 A G 4: 150,158,210 probably null Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Spc25 A G 2: 69,202,601 L60P probably damaging Het
Stam A C 2: 14,138,961 H354P probably damaging Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Tmem120a C G 5: 135,736,277 R254P probably benign Het
Traf5 T C 1: 191,997,876 T405A probably benign Het
Trav7-4 A G 14: 53,461,662 S89G probably benign Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Ugt2b1 C A 5: 86,917,675 V502L probably benign Het
Vip T A 10: 5,642,590 S77T possibly damaging Het
Wdr72 A T 9: 74,218,697 M1025L probably benign Het
Zfp541 A G 7: 16,072,222 D94G probably damaging Het
Other mutations in Cfap54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cfap54 APN 10 93081523 missense unknown
IGL02034:Cfap54 APN 10 93061485 missense probably damaging 0.99
IGL02082:Cfap54 APN 10 93081458 missense unknown
IGL02434:Cfap54 APN 10 93066754 missense probably benign 0.20
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0040:Cfap54 UTSW 10 92977039 missense probably benign 0.33
R0044:Cfap54 UTSW 10 93035433 missense probably null 0.46
R0086:Cfap54 UTSW 10 93028594 missense possibly damaging 0.86
R0104:Cfap54 UTSW 10 93028652 missense probably damaging 1.00
R0194:Cfap54 UTSW 10 93034662 unclassified probably benign
R0234:Cfap54 UTSW 10 92899160 nonsense probably null
R0308:Cfap54 UTSW 10 92885364 missense unknown
R0332:Cfap54 UTSW 10 93035457 missense probably damaging 1.00
R0409:Cfap54 UTSW 10 92776213 missense probably benign 0.00
R0433:Cfap54 UTSW 10 92979080 splice site probably benign
R0436:Cfap54 UTSW 10 93038975 missense possibly damaging 0.95
R0463:Cfap54 UTSW 10 92874943 critical splice donor site probably null
R0523:Cfap54 UTSW 10 92908883 utr 3 prime probably benign
R0551:Cfap54 UTSW 10 93025122 missense probably benign 0.35
R0595:Cfap54 UTSW 10 92884736 missense unknown
R0617:Cfap54 UTSW 10 92829650 splice site probably benign
R0632:Cfap54 UTSW 10 92885096 missense unknown
R0730:Cfap54 UTSW 10 93034737 missense probably benign 0.05
R0786:Cfap54 UTSW 10 92967535 missense possibly damaging 0.72
R0883:Cfap54 UTSW 10 92870669 missense unknown
R1004:Cfap54 UTSW 10 93066696 splice site probably benign
R1033:Cfap54 UTSW 10 92839449 missense probably benign 0.07
R1168:Cfap54 UTSW 10 92937920 missense probably damaging 0.99
R1186:Cfap54 UTSW 10 92875994 missense unknown
R1429:Cfap54 UTSW 10 92821038 missense probably benign 0.01
R1443:Cfap54 UTSW 10 92932721 missense probably damaging 1.00
R1467:Cfap54 UTSW 10 92969763 missense probably benign 0.01
R1557:Cfap54 UTSW 10 92984227 missense possibly damaging 0.68
R1687:Cfap54 UTSW 10 92932640 missense probably damaging 1.00
R1690:Cfap54 UTSW 10 93035442 missense possibly damaging 0.95
R1711:Cfap54 UTSW 10 93011020 missense probably damaging 1.00
R1756:Cfap54 UTSW 10 93048061 missense probably damaging 1.00
R1769:Cfap54 UTSW 10 92904263 critical splice donor site probably null
R1835:Cfap54 UTSW 10 92962375 missense probably benign 0.35
R1889:Cfap54 UTSW 10 93034710 missense possibly damaging 0.94
R1915:Cfap54 UTSW 10 92884702 missense unknown
R1958:Cfap54 UTSW 10 92997342 missense probably benign 0.18
R2005:Cfap54 UTSW 10 92884768 missense unknown
R2018:Cfap54 UTSW 10 93016604 missense probably benign 0.00
R2045:Cfap54 UTSW 10 93038809 splice site probably null
R2059:Cfap54 UTSW 10 92942979 unclassified probably benign
R2100:Cfap54 UTSW 10 93001937 missense possibly damaging 0.84
R2110:Cfap54 UTSW 10 92886367 missense unknown
R2392:Cfap54 UTSW 10 93025011 critical splice donor site probably null
R2508:Cfap54 UTSW 10 92997374 missense possibly damaging 0.72
R2852:Cfap54 UTSW 10 92940155 missense probably damaging 1.00
R2857:Cfap54 UTSW 10 93045282 missense probably damaging 0.99
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R3107:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3108:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3157:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3158:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3159:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3161:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3508:Cfap54 UTSW 10 92885424 missense unknown
R3730:Cfap54 UTSW 10 93011473 nonsense probably null
R3770:Cfap54 UTSW 10 92878536 missense unknown
R3776:Cfap54 UTSW 10 93045100 missense probably damaging 1.00
R3778:Cfap54 UTSW 10 92904344 utr 3 prime probably benign
R3795:Cfap54 UTSW 10 92942873 unclassified probably benign
R3834:Cfap54 UTSW 10 92801123 splice site probably benign
R3891:Cfap54 UTSW 10 93038846 missense possibly damaging 0.87
R3932:Cfap54 UTSW 10 92829757 missense probably benign 0.03
R3974:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3976:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3978:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R4190:Cfap54 UTSW 10 92885023 missense unknown
R4389:Cfap54 UTSW 10 92967500 missense probably benign 0.37
R4542:Cfap54 UTSW 10 93025129 missense probably benign 0.12
R4564:Cfap54 UTSW 10 92839540 unclassified probably benign
R4576:Cfap54 UTSW 10 93043228 critical splice donor site probably null
R4620:Cfap54 UTSW 10 92969757 missense probably benign 0.01
R4714:Cfap54 UTSW 10 92815918 missense probably benign 0.01
R4762:Cfap54 UTSW 10 93061453 splice site probably null
R4776:Cfap54 UTSW 10 92972694 missense possibly damaging 0.96
R4819:Cfap54 UTSW 10 92836477 nonsense probably null
R4827:Cfap54 UTSW 10 92902075 utr 3 prime probably benign
R4832:Cfap54 UTSW 10 92967528 missense probably benign 0.01
R4965:Cfap54 UTSW 10 93066799 missense probably benign 0.23
R5001:Cfap54 UTSW 10 92964534 missense probably benign 0.01
R5060:Cfap54 UTSW 10 93039151 missense probably damaging 1.00
R5067:Cfap54 UTSW 10 93066766 missense probably benign 0.17
R5069:Cfap54 UTSW 10 92937774 missense probably benign
R5094:Cfap54 UTSW 10 92898999 utr 3 prime probably benign
R5109:Cfap54 UTSW 10 92937891 missense probably benign 0.03
R5127:Cfap54 UTSW 10 92886387 splice site probably null
R5143:Cfap54 UTSW 10 93029158 missense possibly damaging 0.73
R5147:Cfap54 UTSW 10 92937838 missense probably benign 0.00
R5158:Cfap54 UTSW 10 93065197 missense probably damaging 1.00
R5256:Cfap54 UTSW 10 92935091 nonsense probably null
R5256:Cfap54 UTSW 10 93045023 splice site probably null
R5266:Cfap54 UTSW 10 92815902 missense probably benign 0.16
R5304:Cfap54 UTSW 10 92821106 missense probably damaging 0.97
R5369:Cfap54 UTSW 10 93061257 intron probably benign
R5406:Cfap54 UTSW 10 93001858 missense probably benign 0.33
R5471:Cfap54 UTSW 10 93028660 missense probably damaging 1.00
R5485:Cfap54 UTSW 10 93029117 missense probably damaging 1.00
R5540:Cfap54 UTSW 10 92972608 missense possibly damaging 0.85
R5586:Cfap54 UTSW 10 92972611 nonsense probably null
R5614:Cfap54 UTSW 10 93045049 missense probably damaging 1.00
R5634:Cfap54 UTSW 10 92904263 critical splice donor site probably benign
R5680:Cfap54 UTSW 10 92979017 nonsense probably null
R5797:Cfap54 UTSW 10 92967576 missense probably benign 0.11
R5859:Cfap54 UTSW 10 93016524 nonsense probably null
R5878:Cfap54 UTSW 10 92964561 missense probably benign 0.01
R5910:Cfap54 UTSW 10 93065181 missense probably damaging 0.99
R5936:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R5994:Cfap54 UTSW 10 93039081 missense probably damaging 0.99
R6080:Cfap54 UTSW 10 93045335 missense possibly damaging 0.64
R6268:Cfap54 UTSW 10 93038909 missense probably damaging 1.00
R6296:Cfap54 UTSW 10 93066846 missense probably damaging 1.00
R6409:Cfap54 UTSW 10 92967492 missense probably benign 0.04
R6545:Cfap54 UTSW 10 92836457 missense probably benign 0.31
R6570:Cfap54 UTSW 10 92815958 missense unknown
R6597:Cfap54 UTSW 10 92999040 missense possibly damaging 0.85
R6702:Cfap54 UTSW 10 92868734 missense unknown
R6703:Cfap54 UTSW 10 92868734 missense unknown
R6720:Cfap54 UTSW 10 92821119 missense probably benign 0.07
R6841:Cfap54 UTSW 10 92875015 missense unknown
R6910:Cfap54 UTSW 10 92836512 missense probably benign 0.29
R6953:Cfap54 UTSW 10 92994678 missense probably benign 0.19
R7009:Cfap54 UTSW 10 92875019 missense unknown
R7129:Cfap54 UTSW 10 93016571 missense probably benign 0.06
R7131:Cfap54 UTSW 10 92821104 missense probably benign 0.03
R7171:Cfap54 UTSW 10 92776210 missense probably damaging 0.99
R7189:Cfap54 UTSW 10 92937728 missense unknown
R7225:Cfap54 UTSW 10 92904374 missense unknown
R7270:Cfap54 UTSW 10 92839458 missense probably benign 0.03
R7323:Cfap54 UTSW 10 92801138 missense probably benign 0.00
R7380:Cfap54 UTSW 10 93047978 missense probably damaging 1.00
R7395:Cfap54 UTSW 10 92884703 missense unknown
R7411:Cfap54 UTSW 10 92868755 missense unknown
R7503:Cfap54 UTSW 10 92887436 splice site probably null
R7622:Cfap54 UTSW 10 92956944 missense unknown
R7679:Cfap54 UTSW 10 92967512 missense probably benign 0.01
R7776:Cfap54 UTSW 10 92868741 missense unknown
R7844:Cfap54 UTSW 10 92902058 missense unknown
R7980:Cfap54 UTSW 10 92982060 missense possibly damaging 0.95
R7988:Cfap54 UTSW 10 92902079 missense unknown
R8101:Cfap54 UTSW 10 92884796 missense unknown
R8119:Cfap54 UTSW 10 92868810 missense unknown
R8134:Cfap54 UTSW 10 92878516 missense unknown
R8168:Cfap54 UTSW 10 92908877 missense unknown
R8179:Cfap54 UTSW 10 92997316 missense possibly damaging 0.68
R8392:Cfap54 UTSW 10 92962417 missense unknown
R8436:Cfap54 UTSW 10 92964536 missense unknown
R8505:Cfap54 UTSW 10 92978993 missense probably benign 0.03
R8671:Cfap54 UTSW 10 92955072 missense unknown
R8716:Cfap54 UTSW 10 92964632 missense probably benign 0.00
R8816:Cfap54 UTSW 10 92878592 missense unknown
R8822:Cfap54 UTSW 10 93039141 missense probably benign 0.09
R8827:Cfap54 UTSW 10 92938248 missense unknown
R8920:Cfap54 UTSW 10 92940337 critical splice acceptor site probably null
R8924:Cfap54 UTSW 10 93001823 missense probably damaging 0.99
R8954:Cfap54 UTSW 10 93043393 missense probably damaging 1.00
R8963:Cfap54 UTSW 10 93028700 nonsense probably null
R9010:Cfap54 UTSW 10 92899059 missense unknown
R9017:Cfap54 UTSW 10 92816021 missense probably benign 0.07
R9093:Cfap54 UTSW 10 92815908 missense probably benign 0.03
R9095:Cfap54 UTSW 10 93011020 missense probably damaging 1.00
R9142:Cfap54 UTSW 10 92984235 missense possibly damaging 0.87
R9178:Cfap54 UTSW 10 92994717 missense probably benign 0.10
R9196:Cfap54 UTSW 10 93037891 missense probably benign 0.22
R9203:Cfap54 UTSW 10 93045128 missense probably benign 0.30
R9258:Cfap54 UTSW 10 92935098 missense unknown
R9275:Cfap54 UTSW 10 93039186 missense possibly damaging 0.86
R9287:Cfap54 UTSW 10 92969703 missense possibly damaging 0.50
R9289:Cfap54 UTSW 10 92821074 missense possibly damaging 0.83
R9310:Cfap54 UTSW 10 92962315 missense unknown
R9397:Cfap54 UTSW 10 92997285 missense probably damaging 0.96
R9462:Cfap54 UTSW 10 92902058 missense unknown
R9697:Cfap54 UTSW 10 92956989 missense unknown
R9746:Cfap54 UTSW 10 92801219 missense probably benign 0.03
R9755:Cfap54 UTSW 10 92921368 missense unknown
X0022:Cfap54 UTSW 10 92878603 missense unknown
X0022:Cfap54 UTSW 10 92932614 missense probably damaging 1.00
X0027:Cfap54 UTSW 10 92878538 missense unknown
X0027:Cfap54 UTSW 10 93001888 missense possibly damaging 0.86
Z1177:Cfap54 UTSW 10 92979026 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTTCACTCAGATGTCAAAATG -3'
(R):5'- AACAGTCTTTCCCTCAGACTCTATG -3'

Sequencing Primer
(F):5'- ACATTAGAAACACACACATATACAGC -3'
(R):5'- TTTCCCTCAGACTCTATGCATAG -3'
Posted On 2015-04-30