Incidental Mutation 'R3973:Ehbp1'
ID 312948
Institutional Source Beutler Lab
Gene Symbol Ehbp1
Ensembl Gene ENSMUSG00000042302
Gene Name EH domain binding protein 1
Synonyms Flj21950, KIAA0903-like
MMRRC Submission 040841-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.859) question?
Stock # R3973 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 21955825-22237086 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 22087867 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 406 (A406T)
Ref Sequence ENSEMBL: ENSMUSP00000136697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045167] [ENSMUST00000109563] [ENSMUST00000180360]
AlphaFold Q69ZW3
Predicted Effect probably benign
Transcript: ENSMUST00000045167
AA Change: A406T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000037489
Gene: ENSMUSG00000042302
AA Change: A406T

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 3.8e-32 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 332 343 N/A INTRINSIC
low complexity region 374 392 N/A INTRINSIC
low complexity region 411 422 N/A INTRINSIC
CH 430 528 1.42e-15 SMART
Blast:CH 757 826 3e-12 BLAST
low complexity region 829 850 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
DUF3585 1043 1187 4.25e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109563
AA Change: A431T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105191
Gene: ENSMUSG00000042302
AA Change: A431T

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 1.3e-29 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 357 368 N/A INTRINSIC
low complexity region 399 417 N/A INTRINSIC
low complexity region 436 447 N/A INTRINSIC
CH 455 553 1.42e-15 SMART
Blast:CH 782 851 3e-12 BLAST
low complexity region 854 875 N/A INTRINSIC
low complexity region 908 923 N/A INTRINSIC
DUF3585 1068 1212 4.25e-61 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152372
Predicted Effect probably benign
Transcript: ENSMUST00000180360
AA Change: A406T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136697
Gene: ENSMUSG00000042302
AA Change: A406T

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 3.8e-32 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 332 343 N/A INTRINSIC
low complexity region 374 392 N/A INTRINSIC
low complexity region 411 422 N/A INTRINSIC
CH 430 528 1.42e-15 SMART
Blast:CH 757 826 3e-12 BLAST
low complexity region 829 850 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
DUF3585 1043 1187 4.25e-61 SMART
Meta Mutation Damage Score 0.0577 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an Eps15 homology domain binding protein. The encoded protein may play a role in endocytic trafficking. A single nucleotide polymorphism in this gene is associated with an aggressive form of prostate cancer. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 148,029,488 (GRCm39) I486T probably damaging Het
4933427D14Rik T C 11: 72,089,567 (GRCm39) R106G probably damaging Het
Cfap54 A G 10: 92,675,333 (GRCm39) S2863P possibly damaging Het
Copa T A 1: 171,948,812 (GRCm39) S1155T probably benign Het
Crot T C 5: 9,027,541 (GRCm39) T264A probably benign Het
Ddx3y G A Y: 1,267,170 (GRCm39) A232V probably damaging Het
Dst T G 1: 34,050,979 (GRCm39) V25G probably benign Het
Eml5 A T 12: 98,768,724 (GRCm39) probably benign Het
Eps8 A T 6: 137,486,153 (GRCm39) M453K probably benign Het
Galnt3 T C 2: 65,937,374 (GRCm39) D112G possibly damaging Het
Glra4 C T X: 135,663,542 (GRCm39) A336T probably damaging Het
Gmppb A G 9: 107,927,338 (GRCm39) D95G probably benign Het
Gprc6a T C 10: 51,504,544 (GRCm39) Y100C possibly damaging Het
Gpx6 C A 13: 21,501,828 (GRCm39) S150Y probably damaging Het
Hsd17b3 A T 13: 64,207,300 (GRCm39) V247D probably damaging Het
Htr7 T C 19: 36,034,160 (GRCm39) D165G probably damaging Het
Igha T C 12: 113,219,972 (GRCm39) probably benign Het
Igsf10 A G 3: 59,239,345 (GRCm39) C279R probably damaging Het
Irak4 A G 15: 94,452,621 (GRCm39) E182G possibly damaging Het
Lipo3 A T 19: 33,535,723 (GRCm39) V274E probably damaging Het
Lrpprc A C 17: 85,078,269 (GRCm39) probably null Het
Mast1 T C 8: 85,645,393 (GRCm39) Y684C probably damaging Het
Mdn1 T C 4: 32,722,363 (GRCm39) F2382L probably benign Het
Mepe C T 5: 104,484,944 (GRCm39) P28L probably benign Het
Mrgpra3 T A 7: 47,239,414 (GRCm39) I171F probably benign Het
Muc2 T A 7: 141,300,541 (GRCm39) probably benign Het
Myh3 C T 11: 66,987,262 (GRCm39) Q1371* probably null Het
Nodal T A 10: 61,258,833 (GRCm39) V90E probably benign Het
Npas4 A T 19: 5,036,579 (GRCm39) H528Q probably benign Het
Nt5dc3 T C 10: 86,660,100 (GRCm39) V382A probably damaging Het
Pcdh18 G A 3: 49,709,035 (GRCm39) T293I probably damaging Het
Phf20l1 A G 15: 66,513,665 (GRCm39) D947G probably damaging Het
Phf8-ps A T 17: 33,285,405 (GRCm39) S466T probably benign Het
Pla2r1 A G 2: 60,279,306 (GRCm39) V758A probably benign Het
Plod2 G T 9: 92,480,672 (GRCm39) G422* probably null Het
Ppp1r12a T C 10: 108,089,341 (GRCm39) V660A probably benign Het
Prdm6 T C 18: 53,673,278 (GRCm39) I186T possibly damaging Het
Prkd3 G A 17: 79,266,570 (GRCm39) probably benign Het
Prrc2a A G 17: 35,376,908 (GRCm39) L734P probably damaging Het
Rnf128 C A X: 138,565,271 (GRCm39) L282I probably damaging Het
Rnf213 A G 11: 119,359,879 (GRCm39) N4424S Het
Scrn3 T C 2: 73,166,121 (GRCm39) S385P possibly damaging Het
Serpina1d A T 12: 103,734,107 (GRCm39) S66T probably benign Het
Setd3 T C 12: 108,131,417 (GRCm39) K3R possibly damaging Het
Slc2a7 A G 4: 150,242,667 (GRCm39) probably null Het
Smad4 G T 18: 73,810,807 (GRCm39) T59K possibly damaging Het
Spc25 A G 2: 69,032,945 (GRCm39) L60P probably damaging Het
Stam A C 2: 14,143,772 (GRCm39) H354P probably damaging Het
Tesk1 C T 4: 43,445,786 (GRCm39) P280S possibly damaging Het
Tmem120a C G 5: 135,765,131 (GRCm39) R254P probably benign Het
Traf5 T C 1: 191,729,837 (GRCm39) T405A probably benign Het
Trav7-4 A G 14: 53,699,119 (GRCm39) S89G probably benign Het
Tsc22d1 T C 14: 76,656,049 (GRCm39) S761P probably damaging Het
Ugt1a10 C A 1: 88,143,862 (GRCm39) H361N probably damaging Het
Ugt2b1 C A 5: 87,065,534 (GRCm39) V502L probably benign Het
Vip T A 10: 5,592,590 (GRCm39) S77T possibly damaging Het
Wdr72 A T 9: 74,125,979 (GRCm39) M1025L probably benign Het
Zfp541 A G 7: 15,806,147 (GRCm39) D94G probably damaging Het
Other mutations in Ehbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ehbp1 APN 11 22,197,967 (GRCm39) splice site probably benign
IGL00786:Ehbp1 APN 11 22,050,460 (GRCm39) missense possibly damaging 0.79
IGL01308:Ehbp1 APN 11 22,088,022 (GRCm39) missense probably damaging 1.00
IGL01322:Ehbp1 APN 11 22,039,636 (GRCm39) missense probably damaging 1.00
IGL01590:Ehbp1 APN 11 22,045,611 (GRCm39) missense possibly damaging 0.91
IGL01611:Ehbp1 APN 11 22,122,883 (GRCm39) missense probably damaging 0.98
IGL01636:Ehbp1 APN 11 22,039,584 (GRCm39) missense probably benign 0.03
IGL01728:Ehbp1 APN 11 22,051,115 (GRCm39) missense probably damaging 1.00
IGL02012:Ehbp1 APN 11 22,051,218 (GRCm39) missense probably damaging 1.00
IGL02034:Ehbp1 APN 11 22,235,486 (GRCm39) critical splice donor site probably null
IGL02324:Ehbp1 APN 11 22,046,048 (GRCm39) missense probably damaging 1.00
IGL02511:Ehbp1 APN 11 22,039,653 (GRCm39) missense probably damaging 1.00
trajan UTSW 11 22,101,850 (GRCm39) missense probably damaging 1.00
K7894:Ehbp1 UTSW 11 22,039,683 (GRCm39) splice site probably benign
PIT4418001:Ehbp1 UTSW 11 22,003,494 (GRCm39) missense probably damaging 1.00
R0218:Ehbp1 UTSW 11 22,181,992 (GRCm39) splice site probably benign
R0294:Ehbp1 UTSW 11 22,045,427 (GRCm39) missense probably benign 0.27
R0398:Ehbp1 UTSW 11 22,045,886 (GRCm39) missense probably damaging 0.99
R0420:Ehbp1 UTSW 11 22,101,836 (GRCm39) missense probably benign
R0468:Ehbp1 UTSW 11 22,119,184 (GRCm39) splice site probably benign
R0943:Ehbp1 UTSW 11 22,045,883 (GRCm39) missense probably benign 0.12
R1181:Ehbp1 UTSW 11 22,012,831 (GRCm39) missense probably benign 0.25
R1481:Ehbp1 UTSW 11 21,956,782 (GRCm39) makesense probably null
R1493:Ehbp1 UTSW 11 21,956,866 (GRCm39) missense probably damaging 1.00
R1563:Ehbp1 UTSW 11 22,009,231 (GRCm39) missense probably damaging 1.00
R1648:Ehbp1 UTSW 11 22,046,000 (GRCm39) missense probably damaging 1.00
R1656:Ehbp1 UTSW 11 22,096,694 (GRCm39) missense probably benign
R1696:Ehbp1 UTSW 11 22,003,441 (GRCm39) missense probably damaging 0.99
R1923:Ehbp1 UTSW 11 22,101,850 (GRCm39) missense probably damaging 1.00
R1950:Ehbp1 UTSW 11 22,009,228 (GRCm39) missense probably damaging 1.00
R2263:Ehbp1 UTSW 11 22,045,462 (GRCm39) missense probably benign
R2436:Ehbp1 UTSW 11 22,039,524 (GRCm39) critical splice donor site probably null
R3148:Ehbp1 UTSW 11 22,050,465 (GRCm39) missense probably damaging 1.00
R3974:Ehbp1 UTSW 11 22,087,867 (GRCm39) missense probably benign 0.00
R4030:Ehbp1 UTSW 11 22,235,498 (GRCm39) missense probably damaging 1.00
R4085:Ehbp1 UTSW 11 22,045,898 (GRCm39) missense possibly damaging 0.95
R4089:Ehbp1 UTSW 11 22,045,898 (GRCm39) missense possibly damaging 0.95
R4524:Ehbp1 UTSW 11 22,101,843 (GRCm39) missense probably damaging 1.00
R4641:Ehbp1 UTSW 11 22,045,892 (GRCm39) missense probably benign 0.00
R4873:Ehbp1 UTSW 11 22,051,164 (GRCm39) missense probably damaging 1.00
R4875:Ehbp1 UTSW 11 22,051,164 (GRCm39) missense probably damaging 1.00
R4914:Ehbp1 UTSW 11 22,096,592 (GRCm39) missense probably benign 0.20
R4915:Ehbp1 UTSW 11 22,096,592 (GRCm39) missense probably benign 0.20
R4916:Ehbp1 UTSW 11 22,096,592 (GRCm39) missense probably benign 0.20
R4917:Ehbp1 UTSW 11 22,096,592 (GRCm39) missense probably benign 0.20
R4918:Ehbp1 UTSW 11 22,096,592 (GRCm39) missense probably benign 0.20
R4929:Ehbp1 UTSW 11 22,189,169 (GRCm39) missense possibly damaging 0.48
R4995:Ehbp1 UTSW 11 22,051,073 (GRCm39) missense probably damaging 1.00
R5325:Ehbp1 UTSW 11 22,045,370 (GRCm39) missense possibly damaging 0.93
R5579:Ehbp1 UTSW 11 22,087,846 (GRCm39) missense probably damaging 1.00
R5979:Ehbp1 UTSW 11 22,101,887 (GRCm39) missense probably benign 0.06
R6025:Ehbp1 UTSW 11 22,189,156 (GRCm39) missense probably damaging 1.00
R6259:Ehbp1 UTSW 11 22,235,684 (GRCm39) start gained probably benign
R6685:Ehbp1 UTSW 11 22,096,641 (GRCm39) missense probably benign 0.01
R6893:Ehbp1 UTSW 11 21,964,945 (GRCm39) missense probably damaging 1.00
R7127:Ehbp1 UTSW 11 22,003,529 (GRCm39) nonsense probably null
R7465:Ehbp1 UTSW 11 22,088,001 (GRCm39) missense probably benign
R7722:Ehbp1 UTSW 11 22,039,572 (GRCm39) missense probably null
R7724:Ehbp1 UTSW 11 22,039,572 (GRCm39) missense probably null
R7797:Ehbp1 UTSW 11 22,046,109 (GRCm39) missense possibly damaging 0.79
R7868:Ehbp1 UTSW 11 22,096,542 (GRCm39) nonsense probably null
R8088:Ehbp1 UTSW 11 22,039,572 (GRCm39) missense probably null
R8218:Ehbp1 UTSW 11 22,046,096 (GRCm39) missense possibly damaging 0.77
R8235:Ehbp1 UTSW 11 22,189,153 (GRCm39) missense probably damaging 1.00
R8267:Ehbp1 UTSW 11 22,096,562 (GRCm39) missense probably benign 0.02
R8318:Ehbp1 UTSW 11 22,087,980 (GRCm39) missense probably benign 0.05
R8334:Ehbp1 UTSW 11 21,957,170 (GRCm39) missense probably damaging 1.00
R8425:Ehbp1 UTSW 11 21,963,495 (GRCm39) missense probably damaging 1.00
R8439:Ehbp1 UTSW 11 22,046,109 (GRCm39) missense possibly damaging 0.79
R8493:Ehbp1 UTSW 11 22,235,842 (GRCm39) start gained probably benign
R8745:Ehbp1 UTSW 11 22,119,064 (GRCm39) missense possibly damaging 0.78
R8824:Ehbp1 UTSW 11 22,182,053 (GRCm39) missense probably damaging 0.98
R8964:Ehbp1 UTSW 11 22,101,154 (GRCm39) nonsense probably null
R8987:Ehbp1 UTSW 11 22,003,531 (GRCm39) missense probably damaging 1.00
R9144:Ehbp1 UTSW 11 22,018,463 (GRCm39) missense probably damaging 1.00
R9187:Ehbp1 UTSW 11 22,101,184 (GRCm39) missense probably damaging 0.99
R9448:Ehbp1 UTSW 11 22,087,881 (GRCm39) missense probably benign
R9549:Ehbp1 UTSW 11 22,012,788 (GRCm39) missense probably benign 0.44
R9612:Ehbp1 UTSW 11 22,119,124 (GRCm39) missense probably damaging 0.99
R9645:Ehbp1 UTSW 11 22,051,052 (GRCm39) missense probably damaging 1.00
R9678:Ehbp1 UTSW 11 22,101,108 (GRCm39) missense possibly damaging 0.89
R9745:Ehbp1 UTSW 11 22,096,692 (GRCm39) missense probably benign 0.19
RF016:Ehbp1 UTSW 11 22,096,646 (GRCm39) missense probably benign
RF037:Ehbp1 UTSW 11 21,956,783 (GRCm39) small deletion probably benign
X0018:Ehbp1 UTSW 11 22,051,085 (GRCm39) missense probably damaging 1.00
Z1176:Ehbp1 UTSW 11 22,045,590 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TAAGTGAGCACCTTTCCAGCC -3'
(R):5'- GAGCCTAAGCCAACTTCTCC -3'

Sequencing Primer
(F):5'- AGAGTAAGCATCAATACACGTTTG -3'
(R):5'- CTAAGCCAACTTCTCCAAATAATTTG -3'
Posted On 2015-04-30