Incidental Mutation 'R3973:Myh3'
ID 312949
Institutional Source Beutler Lab
Gene Symbol Myh3
Ensembl Gene ENSMUSG00000020908
Gene Name myosin, heavy polypeptide 3, skeletal muscle, embryonic
Synonyms Myhse, Myhs-e, MyHC-emb
MMRRC Submission 040841-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.593) question?
Stock # R3973 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 66969126-66993117 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 66987262 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 1371 (Q1371*)
Ref Sequence ENSEMBL: ENSMUSP00000131883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007301] [ENSMUST00000108689] [ENSMUST00000165221]
AlphaFold P13541
Predicted Effect probably null
Transcript: ENSMUST00000007301
AA Change: Q1371*
SMART Domains Protein: ENSMUSP00000007301
Gene: ENSMUSG00000020908
AA Change: Q1371*

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-14 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
low complexity region 844 856 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1020 1028 N/A INTRINSIC
Pfam:Myosin_tail_1 1069 1927 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108689
AA Change: Q1371*
SMART Domains Protein: ENSMUSP00000104329
Gene: ENSMUSG00000020908
AA Change: Q1371*

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-14 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
low complexity region 844 856 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1020 1028 N/A INTRINSIC
Pfam:Myosin_tail_1 1069 1927 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000165221
AA Change: Q1371*
SMART Domains Protein: ENSMUSP00000131883
Gene: ENSMUSG00000020908
AA Change: Q1371*

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 2.2e-13 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
Pfam:Myosin_tail_1 844 1925 2.1e-164 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184592
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. This gene is a member of the MYH family and encodes a protein with an IQ domain and a myosin head-like domain. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 148,029,488 (GRCm39) I486T probably damaging Het
4933427D14Rik T C 11: 72,089,567 (GRCm39) R106G probably damaging Het
Cfap54 A G 10: 92,675,333 (GRCm39) S2863P possibly damaging Het
Copa T A 1: 171,948,812 (GRCm39) S1155T probably benign Het
Crot T C 5: 9,027,541 (GRCm39) T264A probably benign Het
Ddx3y G A Y: 1,267,170 (GRCm39) A232V probably damaging Het
Dst T G 1: 34,050,979 (GRCm39) V25G probably benign Het
Ehbp1 C T 11: 22,087,867 (GRCm39) A406T probably benign Het
Eml5 A T 12: 98,768,724 (GRCm39) probably benign Het
Eps8 A T 6: 137,486,153 (GRCm39) M453K probably benign Het
Galnt3 T C 2: 65,937,374 (GRCm39) D112G possibly damaging Het
Glra4 C T X: 135,663,542 (GRCm39) A336T probably damaging Het
Gmppb A G 9: 107,927,338 (GRCm39) D95G probably benign Het
Gprc6a T C 10: 51,504,544 (GRCm39) Y100C possibly damaging Het
Gpx6 C A 13: 21,501,828 (GRCm39) S150Y probably damaging Het
Hsd17b3 A T 13: 64,207,300 (GRCm39) V247D probably damaging Het
Htr7 T C 19: 36,034,160 (GRCm39) D165G probably damaging Het
Igha T C 12: 113,219,972 (GRCm39) probably benign Het
Igsf10 A G 3: 59,239,345 (GRCm39) C279R probably damaging Het
Irak4 A G 15: 94,452,621 (GRCm39) E182G possibly damaging Het
Lipo3 A T 19: 33,535,723 (GRCm39) V274E probably damaging Het
Lrpprc A C 17: 85,078,269 (GRCm39) probably null Het
Mast1 T C 8: 85,645,393 (GRCm39) Y684C probably damaging Het
Mdn1 T C 4: 32,722,363 (GRCm39) F2382L probably benign Het
Mepe C T 5: 104,484,944 (GRCm39) P28L probably benign Het
Mrgpra3 T A 7: 47,239,414 (GRCm39) I171F probably benign Het
Muc2 T A 7: 141,300,541 (GRCm39) probably benign Het
Nodal T A 10: 61,258,833 (GRCm39) V90E probably benign Het
Npas4 A T 19: 5,036,579 (GRCm39) H528Q probably benign Het
Nt5dc3 T C 10: 86,660,100 (GRCm39) V382A probably damaging Het
Pcdh18 G A 3: 49,709,035 (GRCm39) T293I probably damaging Het
Phf20l1 A G 15: 66,513,665 (GRCm39) D947G probably damaging Het
Phf8-ps A T 17: 33,285,405 (GRCm39) S466T probably benign Het
Pla2r1 A G 2: 60,279,306 (GRCm39) V758A probably benign Het
Plod2 G T 9: 92,480,672 (GRCm39) G422* probably null Het
Ppp1r12a T C 10: 108,089,341 (GRCm39) V660A probably benign Het
Prdm6 T C 18: 53,673,278 (GRCm39) I186T possibly damaging Het
Prkd3 G A 17: 79,266,570 (GRCm39) probably benign Het
Prrc2a A G 17: 35,376,908 (GRCm39) L734P probably damaging Het
Rnf128 C A X: 138,565,271 (GRCm39) L282I probably damaging Het
Rnf213 A G 11: 119,359,879 (GRCm39) N4424S Het
Scrn3 T C 2: 73,166,121 (GRCm39) S385P possibly damaging Het
Serpina1d A T 12: 103,734,107 (GRCm39) S66T probably benign Het
Setd3 T C 12: 108,131,417 (GRCm39) K3R possibly damaging Het
Slc2a7 A G 4: 150,242,667 (GRCm39) probably null Het
Smad4 G T 18: 73,810,807 (GRCm39) T59K possibly damaging Het
Spc25 A G 2: 69,032,945 (GRCm39) L60P probably damaging Het
Stam A C 2: 14,143,772 (GRCm39) H354P probably damaging Het
Tesk1 C T 4: 43,445,786 (GRCm39) P280S possibly damaging Het
Tmem120a C G 5: 135,765,131 (GRCm39) R254P probably benign Het
Traf5 T C 1: 191,729,837 (GRCm39) T405A probably benign Het
Trav7-4 A G 14: 53,699,119 (GRCm39) S89G probably benign Het
Tsc22d1 T C 14: 76,656,049 (GRCm39) S761P probably damaging Het
Ugt1a10 C A 1: 88,143,862 (GRCm39) H361N probably damaging Het
Ugt2b1 C A 5: 87,065,534 (GRCm39) V502L probably benign Het
Vip T A 10: 5,592,590 (GRCm39) S77T possibly damaging Het
Wdr72 A T 9: 74,125,979 (GRCm39) M1025L probably benign Het
Zfp541 A G 7: 15,806,147 (GRCm39) D94G probably damaging Het
Other mutations in Myh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Myh3 APN 11 66,981,681 (GRCm39) missense probably damaging 1.00
IGL01989:Myh3 APN 11 66,977,481 (GRCm39) missense probably damaging 1.00
IGL02097:Myh3 APN 11 66,973,750 (GRCm39) missense probably benign
IGL02197:Myh3 APN 11 66,989,409 (GRCm39) missense probably benign 0.05
IGL02458:Myh3 APN 11 66,987,766 (GRCm39) missense possibly damaging 0.87
IGL02526:Myh3 APN 11 66,978,371 (GRCm39) missense probably benign 0.01
IGL02559:Myh3 APN 11 66,991,921 (GRCm39) missense possibly damaging 0.94
IGL02600:Myh3 APN 11 66,974,227 (GRCm39) missense probably damaging 1.00
IGL02866:Myh3 APN 11 66,979,849 (GRCm39) missense probably benign 0.08
IGL02943:Myh3 APN 11 66,981,891 (GRCm39) missense probably benign 0.02
IGL03087:Myh3 APN 11 66,981,798 (GRCm39) missense probably damaging 1.00
IGL03131:Myh3 APN 11 66,981,935 (GRCm39) splice site probably benign
bud UTSW 11 66,986,833 (GRCm39) critical splice acceptor site probably null
R0049:Myh3 UTSW 11 66,990,498 (GRCm39) missense probably damaging 1.00
R0157:Myh3 UTSW 11 66,973,735 (GRCm39) missense probably benign 0.00
R0266:Myh3 UTSW 11 66,984,498 (GRCm39) missense possibly damaging 0.73
R0352:Myh3 UTSW 11 66,981,254 (GRCm39) missense possibly damaging 0.79
R0391:Myh3 UTSW 11 66,987,333 (GRCm39) splice site probably benign
R0926:Myh3 UTSW 11 66,981,340 (GRCm39) splice site probably null
R1243:Myh3 UTSW 11 66,981,279 (GRCm39) missense possibly damaging 0.80
R1344:Myh3 UTSW 11 66,983,158 (GRCm39) missense probably benign 0.03
R1414:Myh3 UTSW 11 66,989,491 (GRCm39) missense probably damaging 0.98
R1442:Myh3 UTSW 11 66,978,103 (GRCm39) missense possibly damaging 0.77
R1470:Myh3 UTSW 11 66,988,885 (GRCm39) splice site probably benign
R1480:Myh3 UTSW 11 66,984,371 (GRCm39) missense possibly damaging 0.88
R1598:Myh3 UTSW 11 66,983,997 (GRCm39) missense probably damaging 1.00
R1620:Myh3 UTSW 11 66,979,562 (GRCm39) splice site probably benign
R1682:Myh3 UTSW 11 66,979,891 (GRCm39) missense probably damaging 1.00
R1759:Myh3 UTSW 11 66,987,717 (GRCm39) missense probably damaging 0.98
R1772:Myh3 UTSW 11 66,990,220 (GRCm39) missense probably benign 0.32
R1868:Myh3 UTSW 11 66,975,852 (GRCm39) missense probably benign 0.34
R1874:Myh3 UTSW 11 66,984,005 (GRCm39) missense probably benign 0.03
R1885:Myh3 UTSW 11 66,977,453 (GRCm39) missense probably benign 0.23
R1923:Myh3 UTSW 11 66,970,828 (GRCm39) missense probably benign 0.00
R2145:Myh3 UTSW 11 66,981,882 (GRCm39) missense probably benign
R4410:Myh3 UTSW 11 66,975,858 (GRCm39) missense possibly damaging 0.71
R4583:Myh3 UTSW 11 66,987,279 (GRCm39) nonsense probably null
R4650:Myh3 UTSW 11 66,977,270 (GRCm39) missense probably damaging 1.00
R4822:Myh3 UTSW 11 66,979,836 (GRCm39) missense probably benign
R4836:Myh3 UTSW 11 66,987,765 (GRCm39) missense probably benign 0.01
R4898:Myh3 UTSW 11 66,990,233 (GRCm39) missense probably benign 0.05
R4946:Myh3 UTSW 11 66,984,364 (GRCm39) missense probably benign
R5506:Myh3 UTSW 11 66,974,915 (GRCm39) missense probably damaging 1.00
R5534:Myh3 UTSW 11 66,987,870 (GRCm39) missense probably damaging 1.00
R5733:Myh3 UTSW 11 66,979,445 (GRCm39) missense probably benign 0.24
R5889:Myh3 UTSW 11 66,977,201 (GRCm39) missense probably damaging 1.00
R6056:Myh3 UTSW 11 66,978,371 (GRCm39) missense probably benign 0.01
R6223:Myh3 UTSW 11 66,988,843 (GRCm39) missense probably benign
R6228:Myh3 UTSW 11 66,978,312 (GRCm39) missense probably benign 0.17
R6341:Myh3 UTSW 11 66,973,822 (GRCm39) missense probably benign 0.00
R6434:Myh3 UTSW 11 66,973,193 (GRCm39) missense probably damaging 1.00
R6533:Myh3 UTSW 11 66,981,245 (GRCm39) missense probably damaging 0.96
R6812:Myh3 UTSW 11 66,977,228 (GRCm39) missense probably damaging 0.99
R7336:Myh3 UTSW 11 66,981,847 (GRCm39) missense probably benign 0.13
R7354:Myh3 UTSW 11 66,987,708 (GRCm39) missense probably damaging 1.00
R7498:Myh3 UTSW 11 66,987,874 (GRCm39) missense possibly damaging 0.96
R7532:Myh3 UTSW 11 66,981,921 (GRCm39) missense probably benign
R7841:Myh3 UTSW 11 66,989,518 (GRCm39) missense probably damaging 1.00
R7878:Myh3 UTSW 11 66,978,077 (GRCm39) missense probably damaging 1.00
R8169:Myh3 UTSW 11 66,979,856 (GRCm39) missense probably benign 0.06
R8194:Myh3 UTSW 11 66,982,828 (GRCm39) missense probably damaging 1.00
R8215:Myh3 UTSW 11 66,992,005 (GRCm39) missense probably damaging 0.99
R8240:Myh3 UTSW 11 66,983,196 (GRCm39) missense probably benign 0.01
R8255:Myh3 UTSW 11 66,985,848 (GRCm39) missense probably damaging 1.00
R8310:Myh3 UTSW 11 66,986,833 (GRCm39) critical splice acceptor site probably null
R9103:Myh3 UTSW 11 66,989,451 (GRCm39) missense probably benign 0.01
R9249:Myh3 UTSW 11 66,975,855 (GRCm39) missense probably benign 0.12
R9307:Myh3 UTSW 11 66,984,397 (GRCm39) missense possibly damaging 0.57
R9430:Myh3 UTSW 11 66,982,726 (GRCm39) missense possibly damaging 0.94
R9529:Myh3 UTSW 11 66,979,556 (GRCm39) critical splice donor site probably null
R9558:Myh3 UTSW 11 66,983,316 (GRCm39) missense possibly damaging 0.89
R9565:Myh3 UTSW 11 66,983,187 (GRCm39) nonsense probably null
R9691:Myh3 UTSW 11 66,991,921 (GRCm39) missense possibly damaging 0.94
R9790:Myh3 UTSW 11 66,992,005 (GRCm39) missense probably damaging 0.99
R9791:Myh3 UTSW 11 66,992,005 (GRCm39) missense probably damaging 0.99
RF009:Myh3 UTSW 11 66,977,183 (GRCm39) frame shift probably null
RF009:Myh3 UTSW 11 66,977,182 (GRCm39) frame shift probably null
RF009:Myh3 UTSW 11 66,977,181 (GRCm39) frame shift probably null
RF010:Myh3 UTSW 11 66,977,185 (GRCm39) frame shift probably null
RF010:Myh3 UTSW 11 66,977,182 (GRCm39) frame shift probably null
RF013:Myh3 UTSW 11 66,977,182 (GRCm39) frame shift probably null
RF015:Myh3 UTSW 11 66,977,182 (GRCm39) frame shift probably null
X0060:Myh3 UTSW 11 66,985,824 (GRCm39) missense probably benign 0.00
X0062:Myh3 UTSW 11 66,979,942 (GRCm39) missense probably benign 0.03
Z1176:Myh3 UTSW 11 66,973,241 (GRCm39) missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CGCATCTGACTTGTGTGCTG -3'
(R):5'- GCCAGTGTTACATTTAAAGACTCC -3'

Sequencing Primer
(F):5'- TGTACACACTCCTAATCCACTGGG -3'
(R):5'- TCCTTGATGGGGAAATCTTGAGAAAC -3'
Posted On 2015-04-30