Mutagenetix > Incidental Mutation

Incidental Mutation 'R3973:Rnf213'

312951

Institutional Source

Beutler Lab

Gene Symbol

Rnf213

Ensembl Gene

ENSMUSG00000070327

Gene Name

ring finger protein 213

Synonyms

D11Ertd759e

MMRRC Submission

040841-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3973 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119393100-119487418 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119469053 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 4424 (N4424S)

Ref Sequence

ENSEMBL: ENSMUSP00000091429 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]

AlphaFold

no structure available at present

Predicted Effect

SMART Domains

Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: N4424S

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1546	1558	N/A	INTRINSIC
AAA	2373	2515	2.82e-2	SMART
AAA	2722	2890	3.63e-1	SMART
low complexity region	3449	3459	N/A	INTRINSIC
RING	3947	3985	8.69e-5	SMART
Blast:PP2Ac	4544	4722	3e-66	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000131035
AA Change: N4423S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: N4423S

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1113	1127	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
AAA	2372	2514	2.82e-2	SMART
AAA	2721	2889	3.63e-1	SMART
low complexity region	3448	3458	N/A	INTRINSIC
RING	3946	3984	8.69e-5	SMART
Blast:PP2Ac	4542	4720	3e-66	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207133

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207446

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208476

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.3%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	T	C	4: 147,945,031 (GRCm38)	I486T	probably damaging	Het
4921501E09Rik	A	T	17: 33,066,431 (GRCm38)	S466T	probably benign	Het
4933427D14Rik	T	C	11: 72,198,741 (GRCm38)	R106G	probably damaging	Het
Cfap54	A	G	10: 92,839,471 (GRCm38)	S2863P	possibly damaging	Het
Copa	T	A	1: 172,121,245 (GRCm38)	S1155T	probably benign	Het
Crot	T	C	5: 8,977,541 (GRCm38)	T264A	probably benign	Het
Ddx3y	G	A	Y: 1,267,170 (GRCm38)	A232V	probably damaging	Het
Dst	T	G	1: 34,011,898 (GRCm38)	V25G	probably benign	Het
Ehbp1	C	T	11: 22,137,867 (GRCm38)	A406T	probably benign	Het
Eml5	A	T	12: 98,802,465 (GRCm38)		probably benign	Het
Eps8	A	T	6: 137,509,155 (GRCm38)	M453K	probably benign	Het
Galnt3	T	C	2: 66,107,030 (GRCm38)	D112G	possibly damaging	Het
Glra4	C	T	X: 136,762,793 (GRCm38)	A336T	probably damaging	Het
Gmppb	A	G	9: 108,050,139 (GRCm38)	D95G	probably benign	Het
Gprc6a	T	C	10: 51,628,448 (GRCm38)	Y100C	possibly damaging	Het
Gpx6	C	A	13: 21,317,658 (GRCm38)	S150Y	probably damaging	Het
Hsd17b3	A	T	13: 64,059,486 (GRCm38)	V247D	probably damaging	Het
Htr7	T	C	19: 36,056,760 (GRCm38)	D165G	probably damaging	Het
Igha	T	C	12: 113,256,352 (GRCm38)		probably benign	Het
Igsf10	A	G	3: 59,331,924 (GRCm38)	C279R	probably damaging	Het
Irak4	A	G	15: 94,554,740 (GRCm38)	E182G	possibly damaging	Het
Lipo3	A	T	19: 33,558,323 (GRCm38)	V274E	probably damaging	Het
Lrpprc	A	C	17: 84,770,841 (GRCm38)		probably null	Het
Mast1	T	C	8: 84,918,764 (GRCm38)	Y684C	probably damaging	Het
Mdn1	T	C	4: 32,722,363 (GRCm38)	F2382L	probably benign	Het
Mepe	C	T	5: 104,337,078 (GRCm38)	P28L	probably benign	Het
Mrgpra3	T	A	7: 47,589,666 (GRCm38)	I171F	probably benign	Het
Muc2	T	A	7: 141,746,804 (GRCm38)		probably benign	Het
Myh3	C	T	11: 67,096,436 (GRCm38)	Q1371*	probably null	Het
Nodal	T	A	10: 61,423,054 (GRCm38)	V90E	probably benign	Het
Npas4	A	T	19: 4,986,551 (GRCm38)	H528Q	probably benign	Het
Nt5dc3	T	C	10: 86,824,236 (GRCm38)	V382A	probably damaging	Het
Pcdh18	G	A	3: 49,754,586 (GRCm38)	T293I	probably damaging	Het
Phf20l1	A	G	15: 66,641,816 (GRCm38)	D947G	probably damaging	Het
Pla2r1	A	G	2: 60,448,962 (GRCm38)	V758A	probably benign	Het
Plod2	G	T	9: 92,598,619 (GRCm38)	G422*	probably null	Het
Ppp1r12a	T	C	10: 108,253,480 (GRCm38)	V660A	probably benign	Het
Prdm6	T	C	18: 53,540,206 (GRCm38)	I186T	possibly damaging	Het
Prkd3	G	A	17: 78,959,141 (GRCm38)		probably benign	Het
Prrc2a	A	G	17: 35,157,932 (GRCm38)	L734P	probably damaging	Het
Rnf128	C	A	X: 139,664,522 (GRCm38)	L282I	probably damaging	Het
Scrn3	T	C	2: 73,335,777 (GRCm38)	S385P	possibly damaging	Het
Serpina1d	A	T	12: 103,767,848 (GRCm38)	S66T	probably benign	Het
Setd3	T	C	12: 108,165,158 (GRCm38)	K3R	possibly damaging	Het
Slc2a7	A	G	4: 150,158,210 (GRCm38)		probably null	Het
Smad4	G	T	18: 73,677,736 (GRCm38)	T59K	possibly damaging	Het
Spc25	A	G	2: 69,202,601 (GRCm38)	L60P	probably damaging	Het
Stam	A	C	2: 14,138,961 (GRCm38)	H354P	probably damaging	Het
Tesk1	C	T	4: 43,445,786 (GRCm38)	P280S	possibly damaging	Het
Tmem120a	C	G	5: 135,736,277 (GRCm38)	R254P	probably benign	Het
Traf5	T	C	1: 191,997,876 (GRCm38)	T405A	probably benign	Het
Trav7-4	A	G	14: 53,461,662 (GRCm38)	S89G	probably benign	Het
Tsc22d1	T	C	14: 76,418,609 (GRCm38)	S761P	probably damaging	Het
Ugt1a10	C	A	1: 88,216,140 (GRCm38)	H361N	probably damaging	Het
Ugt2b1	C	A	5: 86,917,675 (GRCm38)	V502L	probably benign	Het
Vip	T	A	10: 5,642,590 (GRCm38)	S77T	possibly damaging	Het
Wdr72	A	T	9: 74,218,697 (GRCm38)	M1025L	probably benign	Het
Zfp541	A	G	7: 16,072,222 (GRCm38)	D94G	probably damaging	Het

Other mutations in Rnf213

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Rnf213	APN	11	119,449,343 (GRCm38)	missense	probably benign	0.00
IGL00961:Rnf213	APN	11	119,440,843 (GRCm38)	missense	possibly damaging	0.55
IGL01324:Rnf213	APN	11	119,447,237 (GRCm38)	missense	probably damaging	1.00
IGL01351:Rnf213	APN	11	119,483,118 (GRCm38)	missense	probably benign	0.25
IGL01403:Rnf213	APN	11	119,443,300 (GRCm38)	missense	probably damaging	1.00
IGL01704:Rnf213	APN	11	119,449,876 (GRCm38)	critical splice donor site	probably null
IGL01765:Rnf213	APN	11	119,436,352 (GRCm38)	missense	probably benign	0.00
IGL01803:Rnf213	APN	11	119,441,307 (GRCm38)	missense	probably damaging	1.00
IGL01804:Rnf213	APN	11	119,442,266 (GRCm38)	missense	probably damaging	1.00
IGL01900:Rnf213	APN	11	119,443,015 (GRCm38)	missense	probably benign	0.05
IGL01944:Rnf213	APN	11	119,416,457 (GRCm38)	missense	probably benign	0.01
IGL01982:Rnf213	APN	11	119,443,268 (GRCm38)	missense	probably damaging	1.00
IGL02008:Rnf213	APN	11	119,418,309 (GRCm38)	splice site	probably benign
IGL02084:Rnf213	APN	11	119,445,673 (GRCm38)	missense	probably benign	0.04
IGL02253:Rnf213	APN	11	119,440,650 (GRCm38)	missense	probably benign	0.03
IGL02254:Rnf213	APN	11	119,480,907 (GRCm38)	missense	possibly damaging	0.89
IGL02296:Rnf213	APN	11	119,463,336 (GRCm38)	missense	probably benign	0.01
IGL02531:Rnf213	APN	11	119,436,802 (GRCm38)	missense	probably benign
IGL02588:Rnf213	APN	11	119,416,536 (GRCm38)	missense	probably benign	0.30
IGL02615:Rnf213	APN	11	119,440,789 (GRCm38)	missense	probably damaging	0.96
IGL02805:Rnf213	APN	11	119,435,066 (GRCm38)	missense	probably damaging	0.99
IGL02887:Rnf213	APN	11	119,427,510 (GRCm38)	missense	probably damaging	1.00
IGL03001:Rnf213	APN	11	119,479,941 (GRCm38)	missense	probably damaging	1.00
IGL03035:Rnf213	APN	11	119,445,626 (GRCm38)	splice site	probably benign
IGL03057:Rnf213	APN	11	119,441,087 (GRCm38)	missense	probably damaging	1.00
IGL03148:Rnf213	APN	11	119,465,007 (GRCm38)	missense	probably damaging	1.00
IGL03308:Rnf213	APN	11	119,474,172 (GRCm38)	missense	probably benign	0.03
IGL03339:Rnf213	APN	11	119,443,004 (GRCm38)	missense	probably damaging	1.00
IGL03369:Rnf213	APN	11	119,421,468 (GRCm38)	missense	probably benign	0.34
attrition	UTSW	11	119,430,321 (GRCm38)	missense	possibly damaging	0.77
defame	UTSW	11	119,430,281 (GRCm38)	nonsense	probably null
Derogate	UTSW	11	119,470,210 (GRCm38)	missense	probably damaging	1.00
dinky	UTSW	11	119,416,458 (GRCm38)	missense	probably damaging	0.99
G1funyon_rnf213_024	UTSW	11	119,434,742 (GRCm38)	missense
Impugn	UTSW	11	119,436,823 (GRCm38)	nonsense	probably null
R4332_Rnf213_642	UTSW	11	119,436,676 (GRCm38)	missense	probably damaging	1.00
B6584:Rnf213	UTSW	11	119,426,069 (GRCm38)	missense	probably damaging	0.97
G1Funyon:Rnf213	UTSW	11	119,434,742 (GRCm38)	missense
PIT4585001:Rnf213	UTSW	11	119,458,392 (GRCm38)	missense
R0008:Rnf213	UTSW	11	119,465,052 (GRCm38)	missense	possibly damaging	0.82
R0015:Rnf213	UTSW	11	119,441,606 (GRCm38)	missense	possibly damaging	0.95
R0041:Rnf213	UTSW	11	119,402,575 (GRCm38)	missense	probably benign	0.41
R0114:Rnf213	UTSW	11	119,414,587 (GRCm38)	missense	probably damaging	1.00
R0131:Rnf213	UTSW	11	119,430,361 (GRCm38)	missense	probably benign	0.10
R0131:Rnf213	UTSW	11	119,430,361 (GRCm38)	missense	probably benign	0.10
R0132:Rnf213	UTSW	11	119,430,361 (GRCm38)	missense	probably benign	0.10
R0138:Rnf213	UTSW	11	119,416,496 (GRCm38)	missense	probably benign	0.05
R0144:Rnf213	UTSW	11	119,479,600 (GRCm38)	nonsense	probably null
R0184:Rnf213	UTSW	11	119,414,521 (GRCm38)	missense	probably damaging	0.99
R0321:Rnf213	UTSW	11	119,438,105 (GRCm38)	nonsense	probably null
R0365:Rnf213	UTSW	11	119,426,111 (GRCm38)	missense	possibly damaging	0.74
R0415:Rnf213	UTSW	11	119,414,469 (GRCm38)	missense	probably damaging	1.00
R0421:Rnf213	UTSW	11	119,447,257 (GRCm38)	missense	probably damaging	1.00
R0494:Rnf213	UTSW	11	119,426,012 (GRCm38)	missense	possibly damaging	0.65
R0494:Rnf213	UTSW	11	119,443,120 (GRCm38)	missense	probably damaging	1.00
R0549:Rnf213	UTSW	11	119,465,082 (GRCm38)	missense	probably damaging	1.00
R0577:Rnf213	UTSW	11	119,443,280 (GRCm38)	missense	probably damaging	1.00
R0605:Rnf213	UTSW	11	119,431,717 (GRCm38)	missense	probably benign	0.03
R0638:Rnf213	UTSW	11	119,470,210 (GRCm38)	missense	probably damaging	1.00
R0675:Rnf213	UTSW	11	119,441,834 (GRCm38)	missense	probably benign	0.28
R0715:Rnf213	UTSW	11	119,441,150 (GRCm38)	missense	probably damaging	0.97
R0732:Rnf213	UTSW	11	119,441,068 (GRCm38)	missense	probably damaging	0.99
R0748:Rnf213	UTSW	11	119,473,480 (GRCm38)	missense	probably damaging	1.00
R0765:Rnf213	UTSW	11	119,423,095 (GRCm38)	critical splice donor site	probably null
R0890:Rnf213	UTSW	11	119,430,486 (GRCm38)	missense	possibly damaging	0.94
R0927:Rnf213	UTSW	11	119,414,570 (GRCm38)	missense	probably benign	0.00
R0940:Rnf213	UTSW	11	119,416,563 (GRCm38)	missense	probably benign	0.10
R0959:Rnf213	UTSW	11	119,452,581 (GRCm38)	missense	probably damaging	0.99
R1077:Rnf213	UTSW	11	119,485,998 (GRCm38)	splice site	probably benign
R1104:Rnf213	UTSW	11	119,477,229 (GRCm38)	missense	probably benign	0.29
R1141:Rnf213	UTSW	11	119,435,983 (GRCm38)	missense	probably benign	0.02
R1219:Rnf213	UTSW	11	119,436,177 (GRCm38)	missense	probably damaging	1.00
R1435:Rnf213	UTSW	11	119,436,005 (GRCm38)	missense	probably damaging	1.00
R1444:Rnf213	UTSW	11	119,442,400 (GRCm38)	missense	probably damaging	1.00
R1474:Rnf213	UTSW	11	119,437,750 (GRCm38)	missense	probably damaging	1.00
R1488:Rnf213	UTSW	11	119,480,889 (GRCm38)	missense	probably benign	0.05
R1523:Rnf213	UTSW	11	119,441,888 (GRCm38)	missense	probably damaging	1.00
R1548:Rnf213	UTSW	11	119,442,707 (GRCm38)	missense	probably damaging	1.00
R1554:Rnf213	UTSW	11	119,441,839 (GRCm38)	missense	probably benign	0.06
R1563:Rnf213	UTSW	11	119,414,526 (GRCm38)	missense	probably benign	0.13
R1572:Rnf213	UTSW	11	119,436,611 (GRCm38)	missense	probably damaging	1.00
R1585:Rnf213	UTSW	11	119,463,345 (GRCm38)	missense	probably damaging	1.00
R1635:Rnf213	UTSW	11	119,442,579 (GRCm38)	missense	probably damaging	0.97
R1663:Rnf213	UTSW	11	119,437,672 (GRCm38)	missense	probably benign	0.01
R1789:Rnf213	UTSW	11	119,440,221 (GRCm38)	missense	probably damaging	0.97
R1844:Rnf213	UTSW	11	119,441,183 (GRCm38)	missense	probably damaging	1.00
R1871:Rnf213	UTSW	11	119,450,129 (GRCm38)	missense	probably benign	0.08
R1893:Rnf213	UTSW	11	119,416,448 (GRCm38)	missense	probably damaging	1.00
R1937:Rnf213	UTSW	11	119,431,685 (GRCm38)	missense	probably damaging	1.00
R1967:Rnf213	UTSW	11	119,480,895 (GRCm38)	missense	probably damaging	1.00
R1987:Rnf213	UTSW	11	119,441,107 (GRCm38)	missense	probably damaging	1.00
R2000:Rnf213	UTSW	11	119,436,022 (GRCm38)	missense	probably damaging	1.00
R2020:Rnf213	UTSW	11	119,461,918 (GRCm38)	missense	probably damaging	0.99
R2100:Rnf213	UTSW	11	119,467,302 (GRCm38)	nonsense	probably null
R2109:Rnf213	UTSW	11	119,442,663 (GRCm38)	nonsense	probably null
R2115:Rnf213	UTSW	11	119,428,013 (GRCm38)	missense	probably benign	0.00
R2126:Rnf213	UTSW	11	119,450,201 (GRCm38)	missense	probably damaging	0.99
R2144:Rnf213	UTSW	11	119,443,690 (GRCm38)	missense	probably damaging	0.99
R2145:Rnf213	UTSW	11	119,415,193 (GRCm38)	missense	probably benign	0.03
R2168:Rnf213	UTSW	11	119,415,070 (GRCm38)	missense	probably damaging	0.97
R2189:Rnf213	UTSW	11	119,430,361 (GRCm38)	missense	probably benign	0.10
R2199:Rnf213	UTSW	11	119,460,009 (GRCm38)	missense	probably benign	0.01
R2220:Rnf213	UTSW	11	119,436,428 (GRCm38)	missense	possibly damaging	0.94
R2336:Rnf213	UTSW	11	119,414,604 (GRCm38)	missense	probably benign	0.02
R2400:Rnf213	UTSW	11	119,443,195 (GRCm38)	missense	probably damaging	1.00
R2679:Rnf213	UTSW	11	119,459,938 (GRCm38)	splice site	probably null
R2698:Rnf213	UTSW	11	119,410,144 (GRCm38)	missense	probably benign	0.26
R3151:Rnf213	UTSW	11	119,468,892 (GRCm38)	missense	probably benign	0.03
R3607:Rnf213	UTSW	11	119,441,976 (GRCm38)	nonsense	probably null
R3808:Rnf213	UTSW	11	119,479,558 (GRCm38)	missense	probably damaging	1.00
R3854:Rnf213	UTSW	11	119,480,939 (GRCm38)	splice site	probably benign
R3856:Rnf213	UTSW	11	119,480,939 (GRCm38)	splice site	probably benign
R4014:Rnf213	UTSW	11	119,445,729 (GRCm38)	nonsense	probably null
R4049:Rnf213	UTSW	11	119,482,448 (GRCm38)	missense	possibly damaging	0.67
R4130:Rnf213	UTSW	11	119,483,006 (GRCm38)	missense	probably damaging	1.00
R4153:Rnf213	UTSW	11	119,409,482 (GRCm38)	missense	probably benign	0.27
R4167:Rnf213	UTSW	11	119,441,243 (GRCm38)	missense	probably damaging	0.99
R4224:Rnf213	UTSW	11	119,436,823 (GRCm38)	nonsense	probably null
R4332:Rnf213	UTSW	11	119,436,676 (GRCm38)	missense	probably damaging	1.00
R4415:Rnf213	UTSW	11	119,483,964 (GRCm38)	missense	probably damaging	0.99
R4547:Rnf213	UTSW	11	119,479,670 (GRCm38)	critical splice donor site	probably null
R4609:Rnf213	UTSW	11	119,437,695 (GRCm38)	missense	possibly damaging	0.86
R4684:Rnf213	UTSW	11	119,441,125 (GRCm38)	missense	probably damaging	1.00
R4704:Rnf213	UTSW	11	119,440,349 (GRCm38)	missense	probably damaging	1.00
R4719:Rnf213	UTSW	11	119,420,067 (GRCm38)	missense	probably benign	0.38
R4751:Rnf213	UTSW	11	119,445,745 (GRCm38)	missense	probably benign	0.12
R4828:Rnf213	UTSW	11	119,416,629 (GRCm38)	missense	possibly damaging	0.61
R4837:Rnf213	UTSW	11	119,442,763 (GRCm38)	missense	probably benign	0.00
R4894:Rnf213	UTSW	11	119,481,240 (GRCm38)	missense	probably damaging	1.00
R4973:Rnf213	UTSW	11	119,428,157 (GRCm38)	missense	possibly damaging	0.84
R5026:Rnf213	UTSW	11	119,436,764 (GRCm38)	missense	probably damaging	1.00
R5034:Rnf213	UTSW	11	119,410,807 (GRCm38)	missense	probably damaging	0.99
R5284:Rnf213	UTSW	11	119,458,866 (GRCm38)	missense	possibly damaging	0.89
R5295:Rnf213	UTSW	11	119,440,816 (GRCm38)	missense	probably benign	0.00
R5406:Rnf213	UTSW	11	119,440,808 (GRCm38)	missense	probably damaging	1.00
R5441:Rnf213	UTSW	11	119,409,020 (GRCm38)	missense	probably damaging	0.99
R5449:Rnf213	UTSW	11	119,415,076 (GRCm38)	missense	probably benign	0.44
R5520:Rnf213	UTSW	11	119,433,499 (GRCm38)	missense	probably damaging	1.00
R5636:Rnf213	UTSW	11	119,436,905 (GRCm38)	missense	probably damaging	1.00
R5636:Rnf213	UTSW	11	119,436,629 (GRCm38)	missense	probably benign	0.04
R5669:Rnf213	UTSW	11	119,458,785 (GRCm38)	missense	possibly damaging	0.92
R5670:Rnf213	UTSW	11	119,434,686 (GRCm38)	critical splice acceptor site	probably null
R5697:Rnf213	UTSW	11	119,483,894 (GRCm38)	missense	possibly damaging	0.54
R5726:Rnf213	UTSW	11	119,416,458 (GRCm38)	missense	probably damaging	0.99
R5808:Rnf213	UTSW	11	119,436,295 (GRCm38)	missense	probably benign
R5861:Rnf213	UTSW	11	119,473,377 (GRCm38)	missense	probably damaging	1.00
R5903:Rnf213	UTSW	11	119,421,369 (GRCm38)	missense	probably damaging	0.98
R5949:Rnf213	UTSW	11	119,443,079 (GRCm38)	missense	probably damaging	1.00
R6022:Rnf213	UTSW	11	119,486,010 (GRCm38)	missense	probably benign	0.00
R6043:Rnf213	UTSW	11	119,442,101 (GRCm38)	missense	probably damaging	0.97
R6089:Rnf213	UTSW	11	119,416,559 (GRCm38)	missense	probably benign	0.14
R6123:Rnf213	UTSW	11	119,411,513 (GRCm38)	missense	probably damaging	0.96
R6134:Rnf213	UTSW	11	119,411,470 (GRCm38)	missense	probably damaging	0.99
R6135:Rnf213	UTSW	11	119,442,028 (GRCm38)	missense	probably benign	0.02
R6146:Rnf213	UTSW	11	119,435,999 (GRCm38)	missense	probably benign	0.41
R6163:Rnf213	UTSW	11	119,458,428 (GRCm38)	missense	possibly damaging	0.86
R6272:Rnf213	UTSW	11	119,414,548 (GRCm38)	missense	probably damaging	1.00
R6333:Rnf213	UTSW	11	119,463,366 (GRCm38)	missense	probably damaging	1.00
R6370:Rnf213	UTSW	11	119,477,078 (GRCm38)	missense	probably damaging	0.99
R6456:Rnf213	UTSW	11	119,459,966 (GRCm38)	missense	probably benign	0.03
R6468:Rnf213	UTSW	11	119,452,687 (GRCm38)	missense	possibly damaging	0.94
R6579:Rnf213	UTSW	11	119,436,280 (GRCm38)	missense	probably damaging	0.96
R6648:Rnf213	UTSW	11	119,479,920 (GRCm38)	missense	possibly damaging	0.81
R6727:Rnf213	UTSW	11	119,430,321 (GRCm38)	missense	possibly damaging	0.77
R6739:Rnf213	UTSW	11	119,442,271 (GRCm38)	missense	probably damaging	1.00
R6768:Rnf213	UTSW	11	119,442,236 (GRCm38)	missense	probably damaging	0.99
R6817:Rnf213	UTSW	11	119,462,285 (GRCm38)	critical splice donor site	probably null
R6820:Rnf213	UTSW	11	119,448,838 (GRCm38)	missense	probably damaging	1.00
R6841:Rnf213	UTSW	11	119,449,866 (GRCm38)	missense	probably benign	0.26
R6934:Rnf213	UTSW	11	119,420,067 (GRCm38)	missense	probably benign	0.38
R7026:Rnf213	UTSW	11	119,479,655 (GRCm38)	missense	possibly damaging	0.58
R7094:Rnf213	UTSW	11	119,437,604 (GRCm38)	splice site	probably null
R7170:Rnf213	UTSW	11	119,452,575 (GRCm38)	missense
R7185:Rnf213	UTSW	11	119,424,198 (GRCm38)	missense
R7239:Rnf213	UTSW	11	119,458,788 (GRCm38)	missense
R7258:Rnf213	UTSW	11	119,452,575 (GRCm38)	missense
R7259:Rnf213	UTSW	11	119,452,575 (GRCm38)	missense
R7260:Rnf213	UTSW	11	119,452,575 (GRCm38)	missense
R7273:Rnf213	UTSW	11	119,431,756 (GRCm38)	splice site	probably null
R7282:Rnf213	UTSW	11	119,437,992 (GRCm38)	missense
R7311:Rnf213	UTSW	11	119,416,547 (GRCm38)	missense
R7352:Rnf213	UTSW	11	119,443,579 (GRCm38)	missense
R7369:Rnf213	UTSW	11	119,430,468 (GRCm38)	missense
R7410:Rnf213	UTSW	11	119,435,051 (GRCm38)	missense
R7448:Rnf213	UTSW	11	119,481,291 (GRCm38)	missense
R7561:Rnf213	UTSW	11	119,441,719 (GRCm38)	missense
R7573:Rnf213	UTSW	11	119,458,484 (GRCm38)	missense
R7615:Rnf213	UTSW	11	119,467,297 (GRCm38)	missense
R7680:Rnf213	UTSW	11	119,479,556 (GRCm38)	missense
R7739:Rnf213	UTSW	11	119,410,861 (GRCm38)	missense
R7789:Rnf213	UTSW	11	119,470,219 (GRCm38)	splice site	probably null
R7806:Rnf213	UTSW	11	119,411,545 (GRCm38)	missense
R8031:Rnf213	UTSW	11	119,430,281 (GRCm38)	nonsense	probably null
R8042:Rnf213	UTSW	11	119,441,654 (GRCm38)	missense
R8053:Rnf213	UTSW	11	119,402,647 (GRCm38)	missense
R8284:Rnf213	UTSW	11	119,428,083 (GRCm38)	missense
R8301:Rnf213	UTSW	11	119,434,742 (GRCm38)	missense
R8325:Rnf213	UTSW	11	119,430,445 (GRCm38)	missense
R8332:Rnf213	UTSW	11	119,483,698 (GRCm38)	missense
R8443:Rnf213	UTSW	11	119,449,323 (GRCm38)	missense
R8518:Rnf213	UTSW	11	119,462,217 (GRCm38)	missense
R8531:Rnf213	UTSW	11	119,474,205 (GRCm38)	missense	probably benign	0.02
R8670:Rnf213	UTSW	11	119,458,737 (GRCm38)	missense
R8675:Rnf213	UTSW	11	119,456,158 (GRCm38)	missense
R8690:Rnf213	UTSW	11	119,441,212 (GRCm38)	missense
R8690:Rnf213	UTSW	11	119,418,129 (GRCm38)	missense
R8714:Rnf213	UTSW	11	119,468,894 (GRCm38)	missense
R8802:Rnf213	UTSW	11	119,462,102 (GRCm38)	missense
R8861:Rnf213	UTSW	11	119,442,236 (GRCm38)	missense
R8886:Rnf213	UTSW	11	119,473,438 (GRCm38)	missense
R8893:Rnf213	UTSW	11	119,443,042 (GRCm38)	missense
R8937:Rnf213	UTSW	11	119,430,274 (GRCm38)	missense	possibly damaging	0.94
R8941:Rnf213	UTSW	11	119,414,424 (GRCm38)	missense	probably damaging	1.00
R8973:Rnf213	UTSW	11	119,461,930 (GRCm38)	missense
R8983:Rnf213	UTSW	11	119,430,349 (GRCm38)	missense
R9043:Rnf213	UTSW	11	119,458,913 (GRCm38)	missense
R9081:Rnf213	UTSW	11	119,466,236 (GRCm38)	missense
R9132:Rnf213	UTSW	11	119,483,916 (GRCm38)	missense
R9135:Rnf213	UTSW	11	119,408,747 (GRCm38)	missense
R9146:Rnf213	UTSW	11	119,443,673 (GRCm38)	missense
R9156:Rnf213	UTSW	11	119,440,748 (GRCm38)	missense
R9183:Rnf213	UTSW	11	119,427,622 (GRCm38)	missense
R9234:Rnf213	UTSW	11	119,450,117 (GRCm38)	missense
R9275:Rnf213	UTSW	11	119,435,942 (GRCm38)	missense
R9278:Rnf213	UTSW	11	119,435,942 (GRCm38)	missense
R9296:Rnf213	UTSW	11	119,443,795 (GRCm38)	splice site	probably benign
R9350:Rnf213	UTSW	11	119,442,149 (GRCm38)	missense
R9366:Rnf213	UTSW	11	119,436,231 (GRCm38)	missense
R9413:Rnf213	UTSW	11	119,466,233 (GRCm38)	missense
R9444:Rnf213	UTSW	11	119,434,797 (GRCm38)	missense
R9464:Rnf213	UTSW	11	119,463,580 (GRCm38)	missense
R9605:Rnf213	UTSW	11	119,469,053 (GRCm38)	missense
R9649:Rnf213	UTSW	11	119,479,631 (GRCm38)	missense
R9651:Rnf213	UTSW	11	119,440,412 (GRCm38)	missense
R9664:Rnf213	UTSW	11	119,441,968 (GRCm38)	missense
R9696:Rnf213	UTSW	11	119,468,980 (GRCm38)	missense
R9710:Rnf213	UTSW	11	119,441,005 (GRCm38)	missense
R9797:Rnf213	UTSW	11	119,442,539 (GRCm38)	missense
S24628:Rnf213	UTSW	11	119,414,469 (GRCm38)	missense	probably damaging	1.00
X0021:Rnf213	UTSW	11	119,441,824 (GRCm38)	missense	probably benign	0.14
X0062:Rnf213	UTSW	11	119,473,513 (GRCm38)	missense	probably benign	0.05
X0064:Rnf213	UTSW	11	119,440,463 (GRCm38)	missense	probably damaging	1.00
Z1088:Rnf213	UTSW	11	119,477,254 (GRCm38)	missense	possibly damaging	0.69
Z1176:Rnf213	UTSW	11	119,482,998 (GRCm38)	missense
Z1176:Rnf213	UTSW	11	119,441,410 (GRCm38)	missense

Predicted Primers

PCR Primer
(F):5'- GCTTTGCAAGATCGCTAGTG -3'
(R):5'- CTTTCAATTGTATTCATGCCATTGG -3'

Sequencing Primer
(F):5'- GATCGCTAGTGGATAATACTCTGCC -3'
(R):5'- AGATGGCCTAGTCAGCCATCATTG -3'

Posted On

2015-04-30