Incidental Mutation 'R3973:Setd3'
ID 312954
Institutional Source Beutler Lab
Gene Symbol Setd3
Ensembl Gene ENSMUSG00000056770
Gene Name SET domain containing 3
Synonyms 2610305M23Rik, 2610102I01Rik, D12Ertd771e
MMRRC Submission 040841-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3973 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 108106431-108179314 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108165158 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 3 (K3R)
Ref Sequence ENSEMBL: ENSMUSP00000066413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071095] [ENSMUST00000109879] [ENSMUST00000125916] [ENSMUST00000132682] [ENSMUST00000147466]
AlphaFold Q91WC0
Predicted Effect possibly damaging
Transcript: ENSMUST00000071095
AA Change: K3R

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066413
Gene: ENSMUSG00000056770
AA Change: K3R

DomainStartEndE-ValueType
Pfam:SET 105 314 2.1e-12 PFAM
Pfam:Rubis-subs-bind 345 475 3.7e-31 PFAM
low complexity region 565 577 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109879
AA Change: K3R

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105505
Gene: ENSMUSG00000056770
AA Change: K3R

DomainStartEndE-ValueType
Pfam:SET 105 287 6.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125916
AA Change: K10R

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122520
Gene: ENSMUSG00000056770
AA Change: K10R

DomainStartEndE-ValueType
PDB:3SMT|A 9 155 1e-100 PDB
Blast:SET 101 155 5e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132682
AA Change: K3R

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000123159
Gene: ENSMUSG00000056770
AA Change: K3R

DomainStartEndE-ValueType
PDB:3SMT|A 2 58 3e-30 PDB
SCOP:d1epua_ 50 79 6e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147466
AA Change: K3R

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000121406
Gene: ENSMUSG00000056770
AA Change: K3R

DomainStartEndE-ValueType
PDB:3SMT|A 2 58 3e-30 PDB
SCOP:d1epua_ 50 79 6e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169951
Meta Mutation Damage Score 0.0761 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,031 I486T probably damaging Het
4921501E09Rik A T 17: 33,066,431 S466T probably benign Het
4933427D14Rik T C 11: 72,198,741 R106G probably damaging Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Copa T A 1: 172,121,245 S1155T probably benign Het
Crot T C 5: 8,977,541 T264A probably benign Het
Ddx3y G A Y: 1,267,170 A232V probably damaging Het
Dst T G 1: 34,011,898 V25G probably benign Het
Ehbp1 C T 11: 22,137,867 A406T probably benign Het
Eml5 A T 12: 98,802,465 probably benign Het
Eps8 A T 6: 137,509,155 M453K probably benign Het
Galnt3 T C 2: 66,107,030 D112G possibly damaging Het
Glra4 C T X: 136,762,793 A336T probably damaging Het
Gmppb A G 9: 108,050,139 D95G probably benign Het
Gprc6a T C 10: 51,628,448 Y100C possibly damaging Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Hsd17b3 A T 13: 64,059,486 V247D probably damaging Het
Htr7 T C 19: 36,056,760 D165G probably damaging Het
Igha T C 12: 113,256,352 probably benign Het
Igsf10 A G 3: 59,331,924 C279R probably damaging Het
Irak4 A G 15: 94,554,740 E182G possibly damaging Het
Lipo3 A T 19: 33,558,323 V274E probably damaging Het
Lrpprc A C 17: 84,770,841 probably null Het
Mast1 T C 8: 84,918,764 Y684C probably damaging Het
Mdn1 T C 4: 32,722,363 F2382L probably benign Het
Mepe C T 5: 104,337,078 P28L probably benign Het
Mrgpra3 T A 7: 47,589,666 I171F probably benign Het
Muc2 T A 7: 141,746,804 probably benign Het
Myh3 C T 11: 67,096,436 Q1371* probably null Het
Nodal T A 10: 61,423,054 V90E probably benign Het
Npas4 A T 19: 4,986,551 H528Q probably benign Het
Nt5dc3 T C 10: 86,824,236 V382A probably damaging Het
Pcdh18 G A 3: 49,754,586 T293I probably damaging Het
Phf20l1 A G 15: 66,641,816 D947G probably damaging Het
Pla2r1 A G 2: 60,448,962 V758A probably benign Het
Plod2 G T 9: 92,598,619 G422* probably null Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Prkd3 G A 17: 78,959,141 probably benign Het
Prrc2a A G 17: 35,157,932 L734P probably damaging Het
Rnf128 C A X: 139,664,522 L282I probably damaging Het
Rnf213 A G 11: 119,469,053 N4424S probably benign Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Serpina1d A T 12: 103,767,848 S66T probably benign Het
Slc2a7 A G 4: 150,158,210 probably null Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Spc25 A G 2: 69,202,601 L60P probably damaging Het
Stam A C 2: 14,138,961 H354P probably damaging Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Tmem120a C G 5: 135,736,277 R254P probably benign Het
Traf5 T C 1: 191,997,876 T405A probably benign Het
Trav7-4 A G 14: 53,461,662 S89G probably benign Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Ugt2b1 C A 5: 86,917,675 V502L probably benign Het
Vip T A 10: 5,642,590 S77T possibly damaging Het
Wdr72 A T 9: 74,218,697 M1025L probably benign Het
Zfp541 A G 7: 16,072,222 D94G probably damaging Het
Other mutations in Setd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Setd3 APN 12 108160237 missense probably damaging 1.00
IGL01365:Setd3 APN 12 108157906 missense probably damaging 1.00
IGL02031:Setd3 APN 12 108163030 missense probably damaging 1.00
IGL02826:Setd3 APN 12 108112124 unclassified probably benign
IGL02878:Setd3 APN 12 108108555 critical splice donor site probably null
IGL03039:Setd3 APN 12 108162970 splice site probably null
R0332:Setd3 UTSW 12 108107579 missense probably benign
R1644:Setd3 UTSW 12 108113344 missense possibly damaging 0.88
R1776:Setd3 UTSW 12 108165161 missense probably damaging 1.00
R2018:Setd3 UTSW 12 108118254 missense probably damaging 1.00
R2025:Setd3 UTSW 12 108160267 missense probably damaging 1.00
R2041:Setd3 UTSW 12 108113392 missense possibly damaging 0.84
R2058:Setd3 UTSW 12 108107341 missense probably benign 0.03
R2206:Setd3 UTSW 12 108107285 missense probably benign 0.11
R2207:Setd3 UTSW 12 108107285 missense probably benign 0.11
R3976:Setd3 UTSW 12 108165158 missense possibly damaging 0.93
R3978:Setd3 UTSW 12 108157942 missense possibly damaging 0.63
R4684:Setd3 UTSW 12 108108690 missense probably benign 0.05
R4965:Setd3 UTSW 12 108113371 missense probably benign 0.29
R5691:Setd3 UTSW 12 108160285 missense probably benign 0.19
R5990:Setd3 UTSW 12 108160335 missense probably benign
R6198:Setd3 UTSW 12 108165168 missense possibly damaging 0.66
R6241:Setd3 UTSW 12 108157855 missense probably benign 0.24
R6428:Setd3 UTSW 12 108113338 missense probably damaging 0.99
R7652:Setd3 UTSW 12 108112289 missense probably damaging 1.00
R7913:Setd3 UTSW 12 108107665 missense probably benign 0.37
R8221:Setd3 UTSW 12 108107353 missense possibly damaging 0.91
X0052:Setd3 UTSW 12 108107665 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TAAACCCCTGCAGAGGAGTG -3'
(R):5'- GAGAAGGCGTGCACTTTGTC -3'

Sequencing Primer
(F):5'- GAGTGAAAGGCATGCCACCC -3'
(R):5'- CTGAGACTGCTGTGCATGC -3'
Posted On 2015-04-30