Incidental Mutation 'R3973:Gpx6'
ID 312955
Institutional Source Beutler Lab
Gene Symbol Gpx6
Ensembl Gene ENSMUSG00000004341
Gene Name glutathione peroxidase 6
Synonyms 1700020G18Rik, olfactory
MMRRC Submission 040841-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3973 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 21312125-21319624 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 21317658 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Tyrosine at position 150 (S150Y)
Ref Sequence ENSEMBL: ENSMUSP00000004453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004453]
AlphaFold Q91WR8
Predicted Effect probably damaging
Transcript: ENSMUST00000004453
AA Change: S150Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000004453
Gene: ENSMUSG00000004341
AA Change: S150Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:GSHPx 40 153 1.2e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136668
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: This gene encodes a member of the glutathione peroxidase family. Glutathione peroxidases catalyze the reduction of a variety of hydroperoxides, using glutathione as a specific electron donor substrate. The mouse and the rat orthologs contain Cys, unlike their human counterpart, which is a selenoprotein containing Sec (selenocysteine) at its active site. Expression of this gene is restricted to embryos and adult olfactory epithelium. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,031 I486T probably damaging Het
4921501E09Rik A T 17: 33,066,431 S466T probably benign Het
4933427D14Rik T C 11: 72,198,741 R106G probably damaging Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Copa T A 1: 172,121,245 S1155T probably benign Het
Crot T C 5: 8,977,541 T264A probably benign Het
Ddx3y G A Y: 1,267,170 A232V probably damaging Het
Dst T G 1: 34,011,898 V25G probably benign Het
Ehbp1 C T 11: 22,137,867 A406T probably benign Het
Eml5 A T 12: 98,802,465 probably benign Het
Eps8 A T 6: 137,509,155 M453K probably benign Het
Galnt3 T C 2: 66,107,030 D112G possibly damaging Het
Glra4 C T X: 136,762,793 A336T probably damaging Het
Gmppb A G 9: 108,050,139 D95G probably benign Het
Gprc6a T C 10: 51,628,448 Y100C possibly damaging Het
Hsd17b3 A T 13: 64,059,486 V247D probably damaging Het
Htr7 T C 19: 36,056,760 D165G probably damaging Het
Igha T C 12: 113,256,352 probably benign Het
Igsf10 A G 3: 59,331,924 C279R probably damaging Het
Irak4 A G 15: 94,554,740 E182G possibly damaging Het
Lipo3 A T 19: 33,558,323 V274E probably damaging Het
Lrpprc A C 17: 84,770,841 probably null Het
Mast1 T C 8: 84,918,764 Y684C probably damaging Het
Mdn1 T C 4: 32,722,363 F2382L probably benign Het
Mepe C T 5: 104,337,078 P28L probably benign Het
Mrgpra3 T A 7: 47,589,666 I171F probably benign Het
Muc2 T A 7: 141,746,804 probably benign Het
Myh3 C T 11: 67,096,436 Q1371* probably null Het
Nodal T A 10: 61,423,054 V90E probably benign Het
Npas4 A T 19: 4,986,551 H528Q probably benign Het
Nt5dc3 T C 10: 86,824,236 V382A probably damaging Het
Pcdh18 G A 3: 49,754,586 T293I probably damaging Het
Phf20l1 A G 15: 66,641,816 D947G probably damaging Het
Pla2r1 A G 2: 60,448,962 V758A probably benign Het
Plod2 G T 9: 92,598,619 G422* probably null Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Prkd3 G A 17: 78,959,141 probably benign Het
Prrc2a A G 17: 35,157,932 L734P probably damaging Het
Rnf128 C A X: 139,664,522 L282I probably damaging Het
Rnf213 A G 11: 119,469,053 N4424S Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Serpina1d A T 12: 103,767,848 S66T probably benign Het
Setd3 T C 12: 108,165,158 K3R possibly damaging Het
Slc2a7 A G 4: 150,158,210 probably null Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Spc25 A G 2: 69,202,601 L60P probably damaging Het
Stam A C 2: 14,138,961 H354P probably damaging Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Tmem120a C G 5: 135,736,277 R254P probably benign Het
Traf5 T C 1: 191,997,876 T405A probably benign Het
Trav7-4 A G 14: 53,461,662 S89G probably benign Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Ugt1a10 C A 1: 88,216,140 H361N probably damaging Het
Ugt2b1 C A 5: 86,917,675 V502L probably benign Het
Vip T A 10: 5,642,590 S77T possibly damaging Het
Wdr72 A T 9: 74,218,697 M1025L probably benign Het
Zfp541 A G 7: 16,072,222 D94G probably damaging Het
Other mutations in Gpx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00674:Gpx6 APN 13 21313808 splice site probably benign
Jaded UTSW 13 21317658 missense probably damaging 1.00
R0648:Gpx6 UTSW 13 21318877 missense probably benign 0.44
R0835:Gpx6 UTSW 13 21317068 missense probably damaging 1.00
R1496:Gpx6 UTSW 13 21318920 missense probably benign
R1538:Gpx6 UTSW 13 21313652 missense possibly damaging 0.82
R1839:Gpx6 UTSW 13 21312327 missense probably benign
R2151:Gpx6 UTSW 13 21318971 missense probably damaging 1.00
R2845:Gpx6 UTSW 13 21318875 critical splice acceptor site probably null
R3785:Gpx6 UTSW 13 21313786 missense probably benign 0.02
R3974:Gpx6 UTSW 13 21317658 missense probably damaging 1.00
R3975:Gpx6 UTSW 13 21317658 missense probably damaging 1.00
R4124:Gpx6 UTSW 13 21317645 nonsense probably null
R4707:Gpx6 UTSW 13 21312264 nonsense probably null
R4751:Gpx6 UTSW 13 21317064 missense probably damaging 1.00
R4784:Gpx6 UTSW 13 21312264 nonsense probably null
R4785:Gpx6 UTSW 13 21312264 nonsense probably null
R5002:Gpx6 UTSW 13 21313688 missense probably damaging 1.00
R5403:Gpx6 UTSW 13 21317643 missense probably damaging 1.00
R6004:Gpx6 UTSW 13 21319069 missense probably benign
R6030:Gpx6 UTSW 13 21312340 missense probably benign 0.01
R6030:Gpx6 UTSW 13 21312340 missense probably benign 0.01
R7223:Gpx6 UTSW 13 21317670 critical splice donor site probably null
R9701:Gpx6 UTSW 13 21317607 missense probably benign 0.13
X0017:Gpx6 UTSW 13 21317039 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAATCTTGAGCCCAGAGACTC -3'
(R):5'- AGCATGCTAGCCTACTCCAG -3'

Sequencing Primer
(F):5'- CAATCCTTTCTGTTCCTTTGTGAG -3'
(R):5'- AGCCTACTCCAGAGCTATTGTGTG -3'
Posted On 2015-04-30