Incidental Mutation 'R0386:Mst1r'
ID 31296
Institutional Source Beutler Lab
Gene Symbol Mst1r
Ensembl Gene ENSMUSG00000032584
Gene Name macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
Synonyms Fv2, Ron, STK, friend virus susceptibility 2, CDw136, Fv-2, PTK8
MMRRC Submission 038592-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.261) question?
Stock # R0386 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 107784072-107797582 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 107794003 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035203] [ENSMUST00000035203] [ENSMUST00000195617] [ENSMUST00000195617]
AlphaFold Q62190
Predicted Effect probably null
Transcript: ENSMUST00000035203
SMART Domains Protein: ENSMUSP00000035203
Gene: ENSMUSG00000032584

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 57 510 9.03e-116 SMART
PSI 528 570 8.72e-4 SMART
IPT 570 684 1.63e-18 SMART
IPT 685 769 4.03e-23 SMART
IPT 771 873 8.41e-12 SMART
IPT 878 972 5.36e0 SMART
TyrKc 1059 1318 8.2e-134 SMART
low complexity region 1349 1360 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000035203
SMART Domains Protein: ENSMUSP00000035203
Gene: ENSMUSG00000032584

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 57 510 9.03e-116 SMART
PSI 528 570 8.72e-4 SMART
IPT 570 684 1.63e-18 SMART
IPT 685 769 4.03e-23 SMART
IPT 771 873 8.41e-12 SMART
IPT 878 972 5.36e0 SMART
TyrKc 1059 1318 8.2e-134 SMART
low complexity region 1349 1360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195113
Predicted Effect probably benign
Transcript: ENSMUST00000195617
SMART Domains Protein: ENSMUSP00000142201
Gene: ENSMUSG00000032584

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 57 442 3.5e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195617
SMART Domains Protein: ENSMUSP00000142201
Gene: ENSMUSG00000032584

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 57 442 3.5e-63 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: This gene encodes a precursor protein that is proteolytically cleaved to yield an alpha chain and a beta chain which form a membrane-spanning heterodimer. The encoded protein belongs to a family of cell-surface receptor tyrosine kinases involved in signaling from the cell surface to the intracellular environment. The binding of the encoded protein to its ligand, macrophage-stimulating protein, mediates several biological activities including wound healing, tumor immunity, macrophage activation and hematopoiesis as well as cell growth, motility, survival and adhesion. The protein encoded by this gene also functions in early development and the macrophage-mediated inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: This locus controls susceptibility to splenomegaly or spleen focus formation induced by inoculation with Friend leukemia virus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 77,044,308 (GRCm39) V194A probably damaging Het
Adamts13 G A 2: 26,876,691 (GRCm39) probably null Het
Ahnak T C 19: 8,988,508 (GRCm39) M3264T possibly damaging Het
Birc6 T A 17: 74,906,335 (GRCm39) C1409S probably damaging Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Dnah2 A G 11: 69,338,687 (GRCm39) V3161A probably damaging Het
Dnah5 A T 15: 28,383,727 (GRCm39) Y2983F probably damaging Het
Dnah6 G A 6: 73,060,107 (GRCm39) L2774F probably damaging Het
Dst A T 1: 34,256,917 (GRCm39) T4398S probably damaging Het
Efcab5 G A 11: 77,031,749 (GRCm39) R42W probably damaging Het
Efcab5 A T 11: 77,063,204 (GRCm39) M96K probably benign Het
Elavl4 A G 4: 110,063,902 (GRCm39) probably benign Het
Flt4 G A 11: 49,535,213 (GRCm39) A1214T probably benign Het
Fn1 G T 1: 71,634,945 (GRCm39) T2127N probably damaging Het
Foxj1 A T 11: 116,222,629 (GRCm39) S391R possibly damaging Het
Gabrb1 A T 5: 72,266,150 (GRCm39) Y269F probably damaging Het
Ghitm A G 14: 36,847,868 (GRCm39) S259P possibly damaging Het
Gm16332 A G 1: 139,851,928 (GRCm39) noncoding transcript Het
Gm16380 T A 9: 53,791,727 (GRCm39) noncoding transcript Het
Gm9869 A T 9: 60,745,344 (GRCm39) probably benign Het
Gm9936 G A 5: 114,995,192 (GRCm39) Q142* probably null Het
Hmbs T C 9: 44,248,305 (GRCm39) Y260C probably benign Het
Hoxc5 T A 15: 102,923,784 (GRCm39) C193* probably null Het
Idh2 C T 7: 79,748,005 (GRCm39) A232T probably damaging Het
Lce1j T C 3: 92,696,695 (GRCm39) K28E unknown Het
Lpgat1 C T 1: 191,451,460 (GRCm39) probably benign Het
Lyst T C 13: 13,882,799 (GRCm39) probably benign Het
Megf11 A G 9: 64,547,360 (GRCm39) N235D probably damaging Het
Nr2c2ap A G 8: 70,584,237 (GRCm39) D9G probably benign Het
Obscn T C 11: 59,027,165 (GRCm39) T13A probably damaging Het
Ofcc1 A C 13: 40,367,950 (GRCm39) L188* probably null Het
Oma1 A T 4: 103,182,398 (GRCm39) probably benign Het
Or10aa3 A T 1: 173,877,965 (GRCm39) T9S probably benign Het
Or5m11 A G 2: 85,782,217 (GRCm39) E270G probably damaging Het
Pcm1 T C 8: 41,769,060 (GRCm39) F1642S probably damaging Het
Pglyrp2 A G 17: 32,639,836 (GRCm39) M1T probably null Het
Pnpla5 G T 15: 84,004,920 (GRCm39) L144M probably damaging Het
Prdm10 C A 9: 31,227,596 (GRCm39) T67K probably damaging Het
Ralgapa1 A T 12: 55,754,852 (GRCm39) H1193Q probably benign Het
Sall1 A G 8: 89,759,232 (GRCm39) S291P probably damaging Het
Sdk2 T C 11: 113,784,290 (GRCm39) T150A probably damaging Het
Sel1l2 T A 2: 140,117,361 (GRCm39) Y170F probably benign Het
Sema4a C T 3: 88,344,107 (GRCm39) V715I possibly damaging Het
Smgc G A 15: 91,738,841 (GRCm39) A500T probably benign Het
Spef2 A G 15: 9,584,148 (GRCm39) V1639A probably damaging Het
Srrm4 A G 5: 116,620,437 (GRCm39) probably benign Het
Tbc1d23 G A 16: 57,009,636 (GRCm39) H418Y probably damaging Het
Tbk1 A G 10: 121,420,159 (GRCm39) L10P probably damaging Het
Thumpd3 G A 6: 113,042,621 (GRCm39) probably null Het
Trp53bp1 G T 2: 121,035,424 (GRCm39) T1609K probably damaging Het
Tut1 A G 19: 8,932,919 (GRCm39) N84S probably benign Het
Urb1 C T 16: 90,593,287 (GRCm39) G282R probably damaging Het
Usp19 A T 9: 108,376,910 (GRCm39) D1160V probably damaging Het
Usp9y A G Y: 1,316,933 (GRCm39) V1872A probably damaging Het
Zfp276 C A 8: 123,986,242 (GRCm39) Y386* probably null Het
Other mutations in Mst1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Mst1r APN 9 107,790,449 (GRCm39) splice site probably benign
IGL01327:Mst1r APN 9 107,785,043 (GRCm39) missense probably benign 0.03
IGL01572:Mst1r APN 9 107,788,791 (GRCm39) missense probably damaging 1.00
IGL01968:Mst1r APN 9 107,794,005 (GRCm39) splice site probably null
IGL01983:Mst1r APN 9 107,794,475 (GRCm39) missense probably damaging 0.99
IGL02096:Mst1r APN 9 107,794,478 (GRCm39) missense probably damaging 0.97
IGL02203:Mst1r APN 9 107,785,068 (GRCm39) missense probably damaging 1.00
IGL02203:Mst1r APN 9 107,790,348 (GRCm39) missense possibly damaging 0.61
IGL02332:Mst1r APN 9 107,785,025 (GRCm39) nonsense probably null
IGL02402:Mst1r APN 9 107,794,026 (GRCm39) missense probably damaging 0.99
IGL02404:Mst1r APN 9 107,790,266 (GRCm39) splice site probably benign
IGL02942:Mst1r APN 9 107,790,352 (GRCm39) missense possibly damaging 0.89
IGL02951:Mst1r APN 9 107,785,403 (GRCm39) missense possibly damaging 0.88
IGL02975:Mst1r APN 9 107,790,379 (GRCm39) missense probably benign 0.20
IGL03005:Mst1r APN 9 107,791,748 (GRCm39) nonsense probably null
IGL03304:Mst1r APN 9 107,785,137 (GRCm39) missense probably damaging 1.00
R0833:Mst1r UTSW 9 107,791,975 (GRCm39) missense probably benign 0.00
R0833:Mst1r UTSW 9 107,790,366 (GRCm39) missense probably benign
R1139:Mst1r UTSW 9 107,797,168 (GRCm39) missense possibly damaging 0.93
R1371:Mst1r UTSW 9 107,794,424 (GRCm39) missense probably damaging 1.00
R1477:Mst1r UTSW 9 107,785,523 (GRCm39) missense probably benign
R1479:Mst1r UTSW 9 107,790,544 (GRCm39) splice site probably benign
R1541:Mst1r UTSW 9 107,794,562 (GRCm39) missense probably damaging 0.99
R1698:Mst1r UTSW 9 107,797,179 (GRCm39) missense probably benign 0.06
R1891:Mst1r UTSW 9 107,790,661 (GRCm39) missense probably damaging 1.00
R1971:Mst1r UTSW 9 107,790,411 (GRCm39) missense probably benign 0.06
R1974:Mst1r UTSW 9 107,793,132 (GRCm39) critical splice donor site probably null
R1974:Mst1r UTSW 9 107,791,962 (GRCm39) missense probably damaging 1.00
R2144:Mst1r UTSW 9 107,790,367 (GRCm39) missense probably benign
R2221:Mst1r UTSW 9 107,785,547 (GRCm39) missense probably damaging 1.00
R2356:Mst1r UTSW 9 107,795,069 (GRCm39) missense probably damaging 1.00
R3913:Mst1r UTSW 9 107,791,945 (GRCm39) missense probably benign
R4768:Mst1r UTSW 9 107,788,849 (GRCm39) missense probably damaging 1.00
R4793:Mst1r UTSW 9 107,797,124 (GRCm39) missense probably damaging 0.96
R5141:Mst1r UTSW 9 107,789,440 (GRCm39) missense probably damaging 0.99
R5191:Mst1r UTSW 9 107,788,750 (GRCm39) missense probably damaging 0.98
R5238:Mst1r UTSW 9 107,784,773 (GRCm39) missense probably damaging 1.00
R6024:Mst1r UTSW 9 107,785,350 (GRCm39) missense probably benign 0.00
R6220:Mst1r UTSW 9 107,784,547 (GRCm39) missense probably benign 0.11
R6256:Mst1r UTSW 9 107,794,465 (GRCm39) missense probably damaging 1.00
R6361:Mst1r UTSW 9 107,793,052 (GRCm39) missense probably benign
R6522:Mst1r UTSW 9 107,790,438 (GRCm39) missense probably benign 0.00
R6559:Mst1r UTSW 9 107,785,470 (GRCm39) missense possibly damaging 0.91
R6863:Mst1r UTSW 9 107,797,225 (GRCm39) missense probably benign
R6868:Mst1r UTSW 9 107,793,132 (GRCm39) critical splice donor site probably null
R6873:Mst1r UTSW 9 107,788,843 (GRCm39) missense possibly damaging 0.90
R6978:Mst1r UTSW 9 107,789,793 (GRCm39) missense probably benign 0.23
R7168:Mst1r UTSW 9 107,785,392 (GRCm39) missense probably benign 0.01
R7299:Mst1r UTSW 9 107,791,989 (GRCm39) missense possibly damaging 0.46
R7301:Mst1r UTSW 9 107,791,989 (GRCm39) missense possibly damaging 0.46
R7405:Mst1r UTSW 9 107,792,321 (GRCm39) missense possibly damaging 0.87
R7615:Mst1r UTSW 9 107,797,211 (GRCm39) missense probably benign 0.05
R7684:Mst1r UTSW 9 107,788,762 (GRCm39) missense probably benign 0.01
R7741:Mst1r UTSW 9 107,784,319 (GRCm39) start gained probably benign
R7916:Mst1r UTSW 9 107,784,777 (GRCm39) missense probably damaging 1.00
R7987:Mst1r UTSW 9 107,789,997 (GRCm39) splice site probably null
R8177:Mst1r UTSW 9 107,784,784 (GRCm39) missense probably damaging 1.00
R8356:Mst1r UTSW 9 107,794,463 (GRCm39) missense probably damaging 1.00
R8494:Mst1r UTSW 9 107,791,718 (GRCm39) missense possibly damaging 0.90
R8692:Mst1r UTSW 9 107,792,050 (GRCm39) missense possibly damaging 0.82
R8979:Mst1r UTSW 9 107,792,478 (GRCm39) missense probably damaging 0.98
R9012:Mst1r UTSW 9 107,791,960 (GRCm39) missense probably benign 0.01
X0026:Mst1r UTSW 9 107,790,402 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGCTCTCATCGGTATCATGCTGC -3'
(R):5'- CACCTTGACTGTGAATGACTCGTCC -3'

Sequencing Primer
(F):5'- GTATCATGCTGCCCCCG -3'
(R):5'- TGAATGACTCGTCCAGCCTG -3'
Posted On 2013-04-24