Mutagenetix > Incidental Mutation

Incidental Mutation 'R3973:Phf20l1'

312960

Institutional Source

Beutler Lab

Gene Symbol

Phf20l1

Ensembl Gene

ENSMUSG00000072501

Gene Name

PHD finger protein 20-like 1

Synonyms

CGI-72, E130113K22Rik

MMRRC Submission

040841-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.201) question?

Stock #

R3973 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66577560-66647976 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 66641816 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 947 (D947G)

Ref Sequence

ENSEMBL: ENSMUSP00000155465 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048188] [ENSMUST00000229160] [ENSMUST00000229576] [ENSMUST00000230948]

AlphaFold

Q8CCJ9

Predicted Effect

probably damaging
Transcript: ENSMUST00000048188
AA Change: D974G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000035682
Gene: ENSMUSG00000072501
AA Change: D974G

Domain	Start	End	E-Value	Type
TUDOR	11	71	7.67e0	SMART
Agenet	11	73	3.53e0	SMART
Agenet	85	141	4.54e-1	SMART
TUDOR	85	141	5.75e-8	SMART
Pfam:DUF3776	210	319	1.3e-31	PFAM
Pfam:PHD20L1_u1	318	413	4.7e-47	PFAM
low complexity region	443	453	N/A	INTRINSIC
low complexity region	530	543	N/A	INTRINSIC
low complexity region	547	585	N/A	INTRINSIC
low complexity region	598	608	N/A	INTRINSIC
low complexity region	642	658	N/A	INTRINSIC
PHD	683	727	8.45e-3	SMART
low complexity region	879	887	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229033

Predicted Effect

probably damaging
Transcript: ENSMUST00000229160
AA Change: D973G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000229576

Predicted Effect

probably damaging
Transcript: ENSMUST00000230948
AA Change: D947G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231177

Meta Mutation Damage Score

0.2821

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.3%

Validation Efficiency

98% (61/62)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	T	C	4: 147,945,031	I486T	probably damaging	Het
4921501E09Rik	A	T	17: 33,066,431	S466T	probably benign	Het
4933427D14Rik	T	C	11: 72,198,741	R106G	probably damaging	Het
Cfap54	A	G	10: 92,839,471	S2863P	possibly damaging	Het
Copa	T	A	1: 172,121,245	S1155T	probably benign	Het
Crot	T	C	5: 8,977,541	T264A	probably benign	Het
Ddx3y	G	A	Y: 1,267,170	A232V	probably damaging	Het
Dst	T	G	1: 34,011,898	V25G	probably benign	Het
Ehbp1	C	T	11: 22,137,867	A406T	probably benign	Het
Eml5	A	T	12: 98,802,465		probably benign	Het
Eps8	A	T	6: 137,509,155	M453K	probably benign	Het
Galnt3	T	C	2: 66,107,030	D112G	possibly damaging	Het
Glra4	C	T	X: 136,762,793	A336T	probably damaging	Het
Gmppb	A	G	9: 108,050,139	D95G	probably benign	Het
Gprc6a	T	C	10: 51,628,448	Y100C	possibly damaging	Het
Gpx6	C	A	13: 21,317,658	S150Y	probably damaging	Het
Hsd17b3	A	T	13: 64,059,486	V247D	probably damaging	Het
Htr7	T	C	19: 36,056,760	D165G	probably damaging	Het
Igha	T	C	12: 113,256,352		probably benign	Het
Igsf10	A	G	3: 59,331,924	C279R	probably damaging	Het
Irak4	A	G	15: 94,554,740	E182G	possibly damaging	Het
Lipo3	A	T	19: 33,558,323	V274E	probably damaging	Het
Lrpprc	A	C	17: 84,770,841		probably null	Het
Mast1	T	C	8: 84,918,764	Y684C	probably damaging	Het
Mdn1	T	C	4: 32,722,363	F2382L	probably benign	Het
Mepe	C	T	5: 104,337,078	P28L	probably benign	Het
Mrgpra3	T	A	7: 47,589,666	I171F	probably benign	Het
Muc2	T	A	7: 141,746,804		probably benign	Het
Myh3	C	T	11: 67,096,436	Q1371*	probably null	Het
Nodal	T	A	10: 61,423,054	V90E	probably benign	Het
Npas4	A	T	19: 4,986,551	H528Q	probably benign	Het
Nt5dc3	T	C	10: 86,824,236	V382A	probably damaging	Het
Pcdh18	G	A	3: 49,754,586	T293I	probably damaging	Het
Pla2r1	A	G	2: 60,448,962	V758A	probably benign	Het
Plod2	G	T	9: 92,598,619	G422*	probably null	Het
Ppp1r12a	T	C	10: 108,253,480	V660A	probably benign	Het
Prdm6	T	C	18: 53,540,206	I186T	possibly damaging	Het
Prkd3	G	A	17: 78,959,141		probably benign	Het
Prrc2a	A	G	17: 35,157,932	L734P	probably damaging	Het
Rnf128	C	A	X: 139,664,522	L282I	probably damaging	Het
Rnf213	A	G	11: 119,469,053	N4424S		Het
Scrn3	T	C	2: 73,335,777	S385P	possibly damaging	Het
Serpina1d	A	T	12: 103,767,848	S66T	probably benign	Het
Setd3	T	C	12: 108,165,158	K3R	possibly damaging	Het
Slc2a7	A	G	4: 150,158,210		probably null	Het
Smad4	G	T	18: 73,677,736	T59K	possibly damaging	Het
Spc25	A	G	2: 69,202,601	L60P	probably damaging	Het
Stam	A	C	2: 14,138,961	H354P	probably damaging	Het
Tesk1	C	T	4: 43,445,786	P280S	possibly damaging	Het
Tmem120a	C	G	5: 135,736,277	R254P	probably benign	Het
Traf5	T	C	1: 191,997,876	T405A	probably benign	Het
Trav7-4	A	G	14: 53,461,662	S89G	probably benign	Het
Tsc22d1	T	C	14: 76,418,609	S761P	probably damaging	Het
Ugt1a10	C	A	1: 88,216,140	H361N	probably damaging	Het
Ugt2b1	C	A	5: 86,917,675	V502L	probably benign	Het
Vip	T	A	10: 5,642,590	S77T	possibly damaging	Het
Wdr72	A	T	9: 74,218,697	M1025L	probably benign	Het
Zfp541	A	G	7: 16,072,222	D94G	probably damaging	Het

Other mutations in Phf20l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Phf20l1	APN	15	66629035	missense	probably benign	0.28
IGL00484:Phf20l1	APN	15	66615633	splice site	probably benign
IGL00668:Phf20l1	APN	15	66632849	missense	probably damaging	0.99
IGL00849:Phf20l1	APN	15	66636832	missense	probably benign	0.00
IGL00954:Phf20l1	APN	15	66641908	missense	probably damaging	1.00
IGL01025:Phf20l1	APN	15	66613132	missense	probably damaging	1.00
IGL01504:Phf20l1	APN	15	66597691	missense	possibly damaging	0.73
IGL02087:Phf20l1	APN	15	66628991	missense	probably damaging	1.00
IGL02273:Phf20l1	APN	15	66640025	missense	probably damaging	1.00
IGL02276:Phf20l1	APN	15	66615410	critical splice donor site	probably null
IGL02372:Phf20l1	APN	15	66641801	missense	probably damaging	1.00
IGL02589:Phf20l1	APN	15	66615632	splice site	probably benign
IGL02656:Phf20l1	APN	15	66629827	missense	probably damaging	1.00
IGL02691:Phf20l1	APN	15	66604864	missense	probably damaging	1.00
IGL02881:Phf20l1	APN	15	66594980	critical splice donor site	probably null
IGL02940:Phf20l1	APN	15	66595151	missense	probably damaging	1.00
IGL02943:Phf20l1	APN	15	66594884	missense	probably damaging	1.00
IGL03030:Phf20l1	APN	15	66641947	utr 3 prime	probably benign
IGL03034:Phf20l1	APN	15	66597403	missense	probably damaging	1.00
Abbreviated	UTSW	15	66632903	critical splice donor site	probably null
acadia	UTSW	15	66636820	missense	possibly damaging	0.85
curt	UTSW	15	66639948	missense	possibly damaging	0.90
Cut	UTSW	15	66613039	nonsense	probably null
shorthand	UTSW	15	66609547	missense	probably damaging	1.00
slang	UTSW	15	66641932	missense	probably benign	0.03
PIT4305001:Phf20l1	UTSW	15	66613052	missense	possibly damaging	0.94
R0070:Phf20l1	UTSW	15	66639991	missense	probably damaging	1.00
R0070:Phf20l1	UTSW	15	66639991	missense	probably damaging	1.00
R0562:Phf20l1	UTSW	15	66609604	missense	probably damaging	1.00
R0605:Phf20l1	UTSW	15	66595122	missense	probably damaging	1.00
R0787:Phf20l1	UTSW	15	66615630	splice site	probably benign
R1458:Phf20l1	UTSW	15	66604813	missense	probably damaging	1.00
R1619:Phf20l1	UTSW	15	66615259	missense	possibly damaging	0.88
R1781:Phf20l1	UTSW	15	66632825	missense	probably damaging	1.00
R2360:Phf20l1	UTSW	15	66594920	missense	probably damaging	1.00
R4374:Phf20l1	UTSW	15	66604837	missense	possibly damaging	0.72
R4375:Phf20l1	UTSW	15	66615222	missense	probably benign	0.00
R4554:Phf20l1	UTSW	15	66597367	missense	probably damaging	1.00
R4913:Phf20l1	UTSW	15	66604855	missense	probably benign	0.03
R5092:Phf20l1	UTSW	15	66636913	missense	possibly damaging	0.46
R5491:Phf20l1	UTSW	15	66615785	missense	possibly damaging	0.67
R5713:Phf20l1	UTSW	15	66636820	missense	possibly damaging	0.85
R6126:Phf20l1	UTSW	15	66636824	missense	probably benign	0.02
R6213:Phf20l1	UTSW	15	66632903	critical splice donor site	probably null
R6569:Phf20l1	UTSW	15	66629824	missense	probably damaging	1.00
R6572:Phf20l1	UTSW	15	66609547	missense	probably damaging	1.00
R6808:Phf20l1	UTSW	15	66630913	missense	probably damaging	0.99
R7100:Phf20l1	UTSW	15	66604840	missense	probably benign	0.01
R7208:Phf20l1	UTSW	15	66604789	missense	probably benign	0.05
R7436:Phf20l1	UTSW	15	66597750	missense	possibly damaging	0.92
R7466:Phf20l1	UTSW	15	66636884	missense	probably damaging	1.00
R7604:Phf20l1	UTSW	15	66604084	missense	probably benign	0.02
R7863:Phf20l1	UTSW	15	66615235	missense	possibly damaging	0.94
R7991:Phf20l1	UTSW	15	66630919	missense	possibly damaging	0.64
R8015:Phf20l1	UTSW	15	66639948	missense	possibly damaging	0.90
R8161:Phf20l1	UTSW	15	66604073	missense	probably damaging	1.00
R8228:Phf20l1	UTSW	15	66639940	missense	possibly damaging	0.81
R8857:Phf20l1	UTSW	15	66641932	missense	probably benign	0.03
R9295:Phf20l1	UTSW	15	66641903	missense	probably damaging	1.00
R9393:Phf20l1	UTSW	15	66604106	missense	probably damaging	1.00
R9442:Phf20l1	UTSW	15	66613039	nonsense	probably null
R9522:Phf20l1	UTSW	15	66632820	missense	possibly damaging	0.89
R9727:Phf20l1	UTSW	15	66615382	missense	probably benign	0.01
X0065:Phf20l1	UTSW	15	66597678	missense	probably damaging	0.99
X0065:Phf20l1	UTSW	15	66629806	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AACTACTGTGGGTGGCATG -3'
(R):5'- CCTCATTGATTCTTGGCATAGGTTAC -3'

Sequencing Primer
(F):5'- TGGCATGACTAAGTGCATTGACC -3'
(R):5'- CCAAGATGCCATATTATTGATGTCAC -3'

Posted On

2015-04-30