Incidental Mutation 'R3973:Lipo3'
ID 312969
Institutional Source Beutler Lab
Gene Symbol Lipo3
Ensembl Gene ENSMUSG00000024766
Gene Name lipase, member O3
Synonyms Lipo1
MMRRC Submission 040841-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R3973 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 33532560-33568069 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 33535723 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 274 (V274E)
Ref Sequence ENSEMBL: ENSMUSP00000108127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025694] [ENSMUST00000112508]
AlphaFold Q3UT41
Predicted Effect probably damaging
Transcript: ENSMUST00000025694
AA Change: V274E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025694
Gene: ENSMUSG00000024766
AA Change: V274E

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 33 95 4.2e-24 PFAM
Pfam:Abhydrolase_1 76 213 7.3e-16 PFAM
Pfam:Abhydrolase_5 76 370 4.8e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112508
AA Change: V274E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108127
Gene: ENSMUSG00000024766
AA Change: V274E

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 33 95 8.8e-24 PFAM
Pfam:Abhydrolase_5 76 370 5.2e-12 PFAM
Pfam:Abhydrolase_6 77 384 8.5e-10 PFAM
Pfam:Abhydrolase_1 109 384 2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145807
Meta Mutation Damage Score 0.5107 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 148,029,488 (GRCm39) I486T probably damaging Het
4933427D14Rik T C 11: 72,089,567 (GRCm39) R106G probably damaging Het
Cfap54 A G 10: 92,675,333 (GRCm39) S2863P possibly damaging Het
Copa T A 1: 171,948,812 (GRCm39) S1155T probably benign Het
Crot T C 5: 9,027,541 (GRCm39) T264A probably benign Het
Ddx3y G A Y: 1,267,170 (GRCm39) A232V probably damaging Het
Dst T G 1: 34,050,979 (GRCm39) V25G probably benign Het
Ehbp1 C T 11: 22,087,867 (GRCm39) A406T probably benign Het
Eml5 A T 12: 98,768,724 (GRCm39) probably benign Het
Eps8 A T 6: 137,486,153 (GRCm39) M453K probably benign Het
Galnt3 T C 2: 65,937,374 (GRCm39) D112G possibly damaging Het
Glra4 C T X: 135,663,542 (GRCm39) A336T probably damaging Het
Gmppb A G 9: 107,927,338 (GRCm39) D95G probably benign Het
Gprc6a T C 10: 51,504,544 (GRCm39) Y100C possibly damaging Het
Gpx6 C A 13: 21,501,828 (GRCm39) S150Y probably damaging Het
Hsd17b3 A T 13: 64,207,300 (GRCm39) V247D probably damaging Het
Htr7 T C 19: 36,034,160 (GRCm39) D165G probably damaging Het
Igha T C 12: 113,219,972 (GRCm39) probably benign Het
Igsf10 A G 3: 59,239,345 (GRCm39) C279R probably damaging Het
Irak4 A G 15: 94,452,621 (GRCm39) E182G possibly damaging Het
Lrpprc A C 17: 85,078,269 (GRCm39) probably null Het
Mast1 T C 8: 85,645,393 (GRCm39) Y684C probably damaging Het
Mdn1 T C 4: 32,722,363 (GRCm39) F2382L probably benign Het
Mepe C T 5: 104,484,944 (GRCm39) P28L probably benign Het
Mrgpra3 T A 7: 47,239,414 (GRCm39) I171F probably benign Het
Muc2 T A 7: 141,300,541 (GRCm39) probably benign Het
Myh3 C T 11: 66,987,262 (GRCm39) Q1371* probably null Het
Nodal T A 10: 61,258,833 (GRCm39) V90E probably benign Het
Npas4 A T 19: 5,036,579 (GRCm39) H528Q probably benign Het
Nt5dc3 T C 10: 86,660,100 (GRCm39) V382A probably damaging Het
Pcdh18 G A 3: 49,709,035 (GRCm39) T293I probably damaging Het
Phf20l1 A G 15: 66,513,665 (GRCm39) D947G probably damaging Het
Phf8-ps A T 17: 33,285,405 (GRCm39) S466T probably benign Het
Pla2r1 A G 2: 60,279,306 (GRCm39) V758A probably benign Het
Plod2 G T 9: 92,480,672 (GRCm39) G422* probably null Het
Ppp1r12a T C 10: 108,089,341 (GRCm39) V660A probably benign Het
Prdm6 T C 18: 53,673,278 (GRCm39) I186T possibly damaging Het
Prkd3 G A 17: 79,266,570 (GRCm39) probably benign Het
Prrc2a A G 17: 35,376,908 (GRCm39) L734P probably damaging Het
Rnf128 C A X: 138,565,271 (GRCm39) L282I probably damaging Het
Rnf213 A G 11: 119,359,879 (GRCm39) N4424S Het
Scrn3 T C 2: 73,166,121 (GRCm39) S385P possibly damaging Het
Serpina1d A T 12: 103,734,107 (GRCm39) S66T probably benign Het
Setd3 T C 12: 108,131,417 (GRCm39) K3R possibly damaging Het
Slc2a7 A G 4: 150,242,667 (GRCm39) probably null Het
Smad4 G T 18: 73,810,807 (GRCm39) T59K possibly damaging Het
Spc25 A G 2: 69,032,945 (GRCm39) L60P probably damaging Het
Stam A C 2: 14,143,772 (GRCm39) H354P probably damaging Het
Tesk1 C T 4: 43,445,786 (GRCm39) P280S possibly damaging Het
Tmem120a C G 5: 135,765,131 (GRCm39) R254P probably benign Het
Traf5 T C 1: 191,729,837 (GRCm39) T405A probably benign Het
Trav7-4 A G 14: 53,699,119 (GRCm39) S89G probably benign Het
Tsc22d1 T C 14: 76,656,049 (GRCm39) S761P probably damaging Het
Ugt1a10 C A 1: 88,143,862 (GRCm39) H361N probably damaging Het
Ugt2b1 C A 5: 87,065,534 (GRCm39) V502L probably benign Het
Vip T A 10: 5,592,590 (GRCm39) S77T possibly damaging Het
Wdr72 A T 9: 74,125,979 (GRCm39) M1025L probably benign Het
Zfp541 A G 7: 15,806,147 (GRCm39) D94G probably damaging Het
Other mutations in Lipo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01521:Lipo3 APN 19 33,763,083 (GRCm39) missense probably damaging 1.00
IGL01697:Lipo3 APN 19 33,536,965 (GRCm39) missense probably damaging 1.00
IGL01916:Lipo3 APN 19 33,762,182 (GRCm39) missense probably damaging 1.00
IGL02027:Lipo3 APN 19 33,557,919 (GRCm39) nonsense probably null
IGL02047:Lipo3 APN 19 33,534,562 (GRCm39) missense probably benign 0.00
IGL02586:Lipo3 APN 19 33,559,539 (GRCm39) missense possibly damaging 0.95
IGL03005:Lipo3 APN 19 33,763,136 (GRCm39) missense possibly damaging 0.65
IGL03111:Lipo3 APN 19 33,559,637 (GRCm39) missense probably damaging 0.96
IGL03404:Lipo3 APN 19 33,560,440 (GRCm39) splice site probably benign
R0122:Lipo3 UTSW 19 33,600,086 (GRCm39) intron probably benign
R0128:Lipo3 UTSW 19 33,534,506 (GRCm39) critical splice donor site probably null
R0540:Lipo3 UTSW 19 33,536,967 (GRCm39) missense possibly damaging 0.62
R0551:Lipo3 UTSW 19 33,557,951 (GRCm39) missense probably damaging 1.00
R0568:Lipo3 UTSW 19 33,559,442 (GRCm39) splice site probably benign
R0646:Lipo3 UTSW 19 33,762,169 (GRCm39) nonsense probably null
R0669:Lipo3 UTSW 19 33,537,025 (GRCm39) missense probably benign 0.05
R1704:Lipo3 UTSW 19 33,757,743 (GRCm39) missense possibly damaging 0.87
R1772:Lipo3 UTSW 19 33,764,821 (GRCm39) missense probably benign 0.45
R1862:Lipo3 UTSW 19 33,762,092 (GRCm39) missense probably damaging 1.00
R1863:Lipo3 UTSW 19 33,762,092 (GRCm39) missense probably damaging 1.00
R2911:Lipo3 UTSW 19 33,556,767 (GRCm39) missense probably benign 0.00
R3801:Lipo3 UTSW 19 33,762,257 (GRCm39) missense probably damaging 0.99
R3802:Lipo3 UTSW 19 33,762,257 (GRCm39) missense probably damaging 0.99
R3803:Lipo3 UTSW 19 33,762,257 (GRCm39) missense probably damaging 0.99
R4020:Lipo3 UTSW 19 33,764,804 (GRCm39) missense probably benign 0.00
R4648:Lipo3 UTSW 19 33,760,860 (GRCm39) missense probably damaging 1.00
R4660:Lipo3 UTSW 19 33,598,360 (GRCm39) intron probably benign
R4775:Lipo3 UTSW 19 33,757,795 (GRCm39) missense probably damaging 1.00
R4787:Lipo3 UTSW 19 33,757,749 (GRCm39) missense probably benign 0.00
R4820:Lipo3 UTSW 19 33,560,497 (GRCm39) missense probably damaging 1.00
R4830:Lipo3 UTSW 19 33,753,987 (GRCm39) missense probably damaging 0.99
R4951:Lipo3 UTSW 19 33,759,621 (GRCm39) missense probably benign 0.01
R5117:Lipo3 UTSW 19 33,536,952 (GRCm39) missense probably benign
R5258:Lipo3 UTSW 19 33,591,243 (GRCm39) intron probably benign
R5799:Lipo3 UTSW 19 33,755,093 (GRCm39) intron probably benign
R5853:Lipo3 UTSW 19 33,759,630 (GRCm39) missense probably benign 0.37
R6235:Lipo3 UTSW 19 33,760,963 (GRCm39) missense probably damaging 0.96
R6296:Lipo3 UTSW 19 33,757,737 (GRCm39) missense probably benign 0.10
R6383:Lipo3 UTSW 19 33,533,831 (GRCm39) missense probably benign 0.02
R6659:Lipo3 UTSW 19 33,533,828 (GRCm39) missense possibly damaging 0.55
R6913:Lipo3 UTSW 19 33,757,705 (GRCm39) missense probably benign 0.00
R6915:Lipo3 UTSW 19 33,562,293 (GRCm39) missense probably damaging 1.00
R7092:Lipo3 UTSW 19 33,591,092 (GRCm39) splice site probably null
R7444:Lipo3 UTSW 19 33,535,663 (GRCm39) critical splice donor site probably null
R7532:Lipo3 UTSW 19 33,560,464 (GRCm39) missense possibly damaging 0.90
R7672:Lipo3 UTSW 19 33,757,785 (GRCm39) missense probably benign 0.23
R7796:Lipo3 UTSW 19 33,759,634 (GRCm39) missense possibly damaging 0.75
R7945:Lipo3 UTSW 19 33,533,831 (GRCm39) missense probably benign 0.02
R8683:Lipo3 UTSW 19 33,759,604 (GRCm39) missense probably benign 0.04
R8936:Lipo3 UTSW 19 33,557,880 (GRCm39) missense probably damaging 1.00
R9062:Lipo3 UTSW 19 33,757,714 (GRCm39) missense probably damaging 1.00
R9086:Lipo3 UTSW 19 33,534,529 (GRCm39) missense probably benign 0.44
R9432:Lipo3 UTSW 19 33,533,864 (GRCm39) missense probably damaging 1.00
R9615:Lipo3 UTSW 19 33,754,047 (GRCm39) missense probably benign 0.02
R9620:Lipo3 UTSW 19 33,559,629 (GRCm39) nonsense probably null
Z1176:Lipo3 UTSW 19 33,562,328 (GRCm39) missense probably null 0.97
Predicted Primers PCR Primer
(F):5'- ATGTGGATCAAATACCCTGACCAC -3'
(R):5'- CCCAGACTTGCATTATAAATCGATTGG -3'

Sequencing Primer
(F):5'- CAAAAACAAGTGGGCAAGATTTTCTG -3'
(R):5'- TAACCGTGAACTGGAGCTATACGC -3'
Posted On 2015-04-30