Incidental Mutation 'R3973:Ddx3y'
ID 312973
Institutional Source Beutler Lab
Gene Symbol Ddx3y
Ensembl Gene ENSMUSG00000069045
Gene Name DEAD box helicase 3, Y-linked
Synonyms 8030469F12Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked, D1Pas1-rs1, Dby
MMRRC Submission 040841-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.029) question?
Stock # R3973 (G1)
Quality Score 222
Status Validated
Chromosome Y
Chromosomal Location 1260771-1286629 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 1267170 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 232 (A232V)
Ref Sequence ENSEMBL: ENSMUSP00000088729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091190] [ENSMUST00000188484]
AlphaFold Q62095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084813
Predicted Effect probably damaging
Transcript: ENSMUST00000091190
AA Change: A232V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088729
Gene: ENSMUSG00000069045
AA Change: A232V

DomainStartEndE-ValueType
low complexity region 124 136 N/A INTRINSIC
low complexity region 184 195 N/A INTRINSIC
DEXDc 198 417 3.39e-65 SMART
HELICc 454 535 2.61e-34 SMART
low complexity region 580 596 N/A INTRINSIC
low complexity region 603 650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188182
Predicted Effect probably benign
Transcript: ENSMUST00000188484
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the DEAD-box RNA helicase family, characterized by nine conserved motifs, included the conserved Asp-Glu-Ala-Asp (DEAD) motif. These motifs are thought to be involved in ATP binding, hydrolysis, RNA binding, and in the formation of intramolecular interactions. This protein shares high similarity to DDX3X, on the X chromosome, but a deletion of this gene is not complemented by DDX3X. Mutations in this gene result in male infertility, a reduction in germ cell numbers, and can result in Sertoli-cell only sydrome. Pseudogenes sharing similarity to both this gene and the DDX3X paralog are found on chromosome 4 and the X chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 148,029,488 (GRCm39) I486T probably damaging Het
4933427D14Rik T C 11: 72,089,567 (GRCm39) R106G probably damaging Het
Cfap54 A G 10: 92,675,333 (GRCm39) S2863P possibly damaging Het
Copa T A 1: 171,948,812 (GRCm39) S1155T probably benign Het
Crot T C 5: 9,027,541 (GRCm39) T264A probably benign Het
Dst T G 1: 34,050,979 (GRCm39) V25G probably benign Het
Ehbp1 C T 11: 22,087,867 (GRCm39) A406T probably benign Het
Eml5 A T 12: 98,768,724 (GRCm39) probably benign Het
Eps8 A T 6: 137,486,153 (GRCm39) M453K probably benign Het
Galnt3 T C 2: 65,937,374 (GRCm39) D112G possibly damaging Het
Glra4 C T X: 135,663,542 (GRCm39) A336T probably damaging Het
Gmppb A G 9: 107,927,338 (GRCm39) D95G probably benign Het
Gprc6a T C 10: 51,504,544 (GRCm39) Y100C possibly damaging Het
Gpx6 C A 13: 21,501,828 (GRCm39) S150Y probably damaging Het
Hsd17b3 A T 13: 64,207,300 (GRCm39) V247D probably damaging Het
Htr7 T C 19: 36,034,160 (GRCm39) D165G probably damaging Het
Igha T C 12: 113,219,972 (GRCm39) probably benign Het
Igsf10 A G 3: 59,239,345 (GRCm39) C279R probably damaging Het
Irak4 A G 15: 94,452,621 (GRCm39) E182G possibly damaging Het
Lipo3 A T 19: 33,535,723 (GRCm39) V274E probably damaging Het
Lrpprc A C 17: 85,078,269 (GRCm39) probably null Het
Mast1 T C 8: 85,645,393 (GRCm39) Y684C probably damaging Het
Mdn1 T C 4: 32,722,363 (GRCm39) F2382L probably benign Het
Mepe C T 5: 104,484,944 (GRCm39) P28L probably benign Het
Mrgpra3 T A 7: 47,239,414 (GRCm39) I171F probably benign Het
Muc2 T A 7: 141,300,541 (GRCm39) probably benign Het
Myh3 C T 11: 66,987,262 (GRCm39) Q1371* probably null Het
Nodal T A 10: 61,258,833 (GRCm39) V90E probably benign Het
Npas4 A T 19: 5,036,579 (GRCm39) H528Q probably benign Het
Nt5dc3 T C 10: 86,660,100 (GRCm39) V382A probably damaging Het
Pcdh18 G A 3: 49,709,035 (GRCm39) T293I probably damaging Het
Phf20l1 A G 15: 66,513,665 (GRCm39) D947G probably damaging Het
Phf8-ps A T 17: 33,285,405 (GRCm39) S466T probably benign Het
Pla2r1 A G 2: 60,279,306 (GRCm39) V758A probably benign Het
Plod2 G T 9: 92,480,672 (GRCm39) G422* probably null Het
Ppp1r12a T C 10: 108,089,341 (GRCm39) V660A probably benign Het
Prdm6 T C 18: 53,673,278 (GRCm39) I186T possibly damaging Het
Prkd3 G A 17: 79,266,570 (GRCm39) probably benign Het
Prrc2a A G 17: 35,376,908 (GRCm39) L734P probably damaging Het
Rnf128 C A X: 138,565,271 (GRCm39) L282I probably damaging Het
Rnf213 A G 11: 119,359,879 (GRCm39) N4424S Het
Scrn3 T C 2: 73,166,121 (GRCm39) S385P possibly damaging Het
Serpina1d A T 12: 103,734,107 (GRCm39) S66T probably benign Het
Setd3 T C 12: 108,131,417 (GRCm39) K3R possibly damaging Het
Slc2a7 A G 4: 150,242,667 (GRCm39) probably null Het
Smad4 G T 18: 73,810,807 (GRCm39) T59K possibly damaging Het
Spc25 A G 2: 69,032,945 (GRCm39) L60P probably damaging Het
Stam A C 2: 14,143,772 (GRCm39) H354P probably damaging Het
Tesk1 C T 4: 43,445,786 (GRCm39) P280S possibly damaging Het
Tmem120a C G 5: 135,765,131 (GRCm39) R254P probably benign Het
Traf5 T C 1: 191,729,837 (GRCm39) T405A probably benign Het
Trav7-4 A G 14: 53,699,119 (GRCm39) S89G probably benign Het
Tsc22d1 T C 14: 76,656,049 (GRCm39) S761P probably damaging Het
Ugt1a10 C A 1: 88,143,862 (GRCm39) H361N probably damaging Het
Ugt2b1 C A 5: 87,065,534 (GRCm39) V502L probably benign Het
Vip T A 10: 5,592,590 (GRCm39) S77T possibly damaging Het
Wdr72 A T 9: 74,125,979 (GRCm39) M1025L probably benign Het
Zfp541 A G 7: 15,806,147 (GRCm39) D94G probably damaging Het
Other mutations in Ddx3y
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03134:Ddx3y UTSW Y 1,278,949 (GRCm39) missense possibly damaging 0.93
R0326:Ddx3y UTSW Y 1,263,321 (GRCm39) nonsense probably null
R1755:Ddx3y UTSW Y 1,279,543 (GRCm39) missense probably benign 0.00
R2029:Ddx3y UTSW Y 1,266,389 (GRCm39) missense probably benign 0.05
R2076:Ddx3y UTSW Y 1,266,593 (GRCm39) critical splice donor site probably null
R3610:Ddx3y UTSW Y 1,263,928 (GRCm39) missense probably null 1.00
R5041:Ddx3y UTSW Y 1,266,611 (GRCm39) missense probably benign 0.05
R5396:Ddx3y UTSW Y 1,265,965 (GRCm39) missense probably damaging 1.00
R6266:Ddx3y UTSW Y 1,266,635 (GRCm39) missense probably damaging 1.00
R6473:Ddx3y UTSW Y 1,265,971 (GRCm39) missense possibly damaging 0.93
R7048:Ddx3y UTSW Y 1,279,491 (GRCm39) missense probably benign 0.00
R7900:Ddx3y UTSW Y 1,266,594 (GRCm39) critical splice donor site probably null
R8090:Ddx3y UTSW Y 1,264,897 (GRCm39) missense probably benign 0.00
R8203:Ddx3y UTSW Y 1,269,827 (GRCm39) missense probably benign
R9005:Ddx3y UTSW Y 1,282,919 (GRCm39) missense probably damaging 0.98
R9491:Ddx3y UTSW Y 1,279,465 (GRCm39) missense probably benign 0.01
R9555:Ddx3y UTSW Y 1,265,895 (GRCm39) missense probably benign 0.00
R9638:Ddx3y UTSW Y 1,263,599 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCACAGTGCCACATGTAATTTAAG -3'
(R):5'- TGCTTCACATAGTCATAGACCAGG -3'

Sequencing Primer
(F):5'- TTGAACTGGAAACACACAAATGTCTC -3'
(R):5'- CCAGGATGACCTTAGGCTTACTAG -3'
Posted On 2015-04-30