Incidental Mutation 'R4026:Tlr12'
ID312979
Institutional Source Beutler Lab
Gene Symbol Tlr12
Ensembl Gene ENSMUSG00000062545
Gene Nametoll-like receptor 12
SynonymsLOC384059, Tlr11
MMRRC Submission 040849-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4026 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location128615443-128618619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 128616508 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 650 (E650K)
Ref Sequence ENSEMBL: ENSMUSP00000074381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074829]
Predicted Effect probably benign
Transcript: ENSMUST00000074829
AA Change: E650K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074381
Gene: ENSMUSG00000062545
AA Change: E650K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 253 266 N/A INTRINSIC
LRR 291 314 1.67e2 SMART
LRR 315 338 9.24e1 SMART
LRR_TYP 341 364 2.79e-4 SMART
LRR 365 388 4.34e-1 SMART
LRR 389 412 1.37e1 SMART
LRR 413 436 1.71e2 SMART
low complexity region 443 459 N/A INTRINSIC
low complexity region 494 502 N/A INTRINSIC
LRR 591 614 5.56e0 SMART
Pfam:TIR 760 905 5.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133382
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation exhibit a greatly increased susceptibility to kidney infection by uropathogenic bacteria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Ahnak G T 19: 9,011,299 V3316F probably damaging Het
Cacna1a C T 8: 84,581,333 T1409I probably damaging Het
Ccdc158 A G 5: 92,643,807 M698T probably benign Het
Ces2g T A 8: 104,964,745 V171E probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dspp G A 5: 104,177,697 S642N unknown Het
Fezf2 A T 14: 12,343,986 C302S probably damaging Het
Gm10754 A G 10: 97,682,116 probably benign Het
Gm5581 G A 6: 131,167,068 noncoding transcript Het
Gm7929 T C 14: 41,750,552 K21E probably damaging Het
Hmcn1 A T 1: 150,722,369 D1727E probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Micu3 A G 8: 40,359,455 probably benign Het
Mrpl3 T C 9: 105,071,486 probably null Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Ncam1 T C 9: 49,564,995 I265V probably benign Het
Ncoa7 T C 10: 30,722,724 T68A probably benign Het
Oprk1 T C 1: 5,598,685 V118A probably benign Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sidt1 A G 16: 44,281,886 S304P possibly damaging Het
Srsf6 T A 2: 162,934,291 probably benign Het
Tas2r105 A G 6: 131,686,826 V213A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trav4-2 T A 14: 53,418,830 D96E possibly damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vmn2r89 T C 14: 51,452,043 M1T probably null Het
Wdr20 A G 12: 110,793,516 T279A probably benign Het
Zfp407 A G 18: 84,559,596 S1131P possibly damaging Het
Zfyve1 A G 12: 83,594,522 V120A probably benign Het
Other mutations in Tlr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Tlr12 APN 4 128617422 missense probably benign 0.00
IGL00654:Tlr12 APN 4 128617440 missense probably benign 0.27
IGL01290:Tlr12 APN 4 128617837 missense probably damaging 1.00
IGL01406:Tlr12 APN 4 128616339 nonsense probably null
IGL01550:Tlr12 APN 4 128615742 missense probably damaging 1.00
IGL02590:Tlr12 APN 4 128617389 missense probably benign 0.00
IGL02592:Tlr12 APN 4 128617686 missense probably benign 0.02
IGL02635:Tlr12 APN 4 128616816 missense probably damaging 0.98
IGL02714:Tlr12 APN 4 128617713 missense probably damaging 1.00
IGL03104:Tlr12 APN 4 128615892 missense probably benign 0.01
IGL03131:Tlr12 APN 4 128615877 missense probably damaging 1.00
IGL03329:Tlr12 APN 4 128616852 missense possibly damaging 0.84
IGL03354:Tlr12 APN 4 128615937 missense probably damaging 1.00
R0848:Tlr12 UTSW 4 128616291 missense probably benign 0.05
R1536:Tlr12 UTSW 4 128617752 missense possibly damaging 0.95
R1807:Tlr12 UTSW 4 128617436 missense probably benign 0.21
R1989:Tlr12 UTSW 4 128617069 missense probably benign 0.04
R2905:Tlr12 UTSW 4 128616009 missense probably damaging 1.00
R3870:Tlr12 UTSW 4 128616568 missense probably benign 0.00
R4296:Tlr12 UTSW 4 128617788 missense probably damaging 1.00
R4398:Tlr12 UTSW 4 128616195 missense probably benign 0.09
R4528:Tlr12 UTSW 4 128618025 missense probably damaging 1.00
R4559:Tlr12 UTSW 4 128615770 missense probably damaging 1.00
R4599:Tlr12 UTSW 4 128617332 missense probably benign 0.06
R4999:Tlr12 UTSW 4 128617680 missense probably benign 0.38
R5054:Tlr12 UTSW 4 128617270 nonsense probably null
R5177:Tlr12 UTSW 4 128618376 missense probably damaging 0.96
R5207:Tlr12 UTSW 4 128616709 nonsense probably null
R5533:Tlr12 UTSW 4 128615863 missense probably damaging 0.99
R6484:Tlr12 UTSW 4 128616054 missense probably damaging 1.00
R6568:Tlr12 UTSW 4 128617992 missense probably benign 0.10
R6821:Tlr12 UTSW 4 128616892 missense possibly damaging 0.95
R7465:Tlr12 UTSW 4 128616170 missense probably damaging 1.00
R7594:Tlr12 UTSW 4 128617680 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TTTCAGCTCCAACGTCTGGG -3'
(R):5'- TCGCTTCAGTCCATAACCCAG -3'

Sequencing Primer
(F):5'- AACGTCTGGGGGCAGTG -3'
(R):5'- GTGACCTTCCACAGCTCCAG -3'
Posted On2015-04-30