Incidental Mutation 'R4026:Micu3'
ID312986
Institutional Source Beutler Lab
Gene Symbol Micu3
Ensembl Gene ENSMUSG00000039478
Gene Namemitochondrial calcium uptake family, member 3
SynonymsEfha2, 2900075B16Rik
MMRRC Submission 040849-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4026 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location40307458-40386308 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 40359455 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000068999]
Predicted Effect probably benign
Transcript: ENSMUST00000068999
SMART Domains Protein: ENSMUSP00000070241
Gene: ENSMUSG00000039478

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 69 80 N/A INTRINSIC
EFh 229 257 3.93e0 SMART
Blast:EFh 332 360 1e-5 BLAST
EFh 467 495 5.36e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132481
Predicted Effect probably benign
Transcript: ENSMUST00000136835
SMART Domains Protein: ENSMUSP00000118883
Gene: ENSMUSG00000039478

DomainStartEndE-ValueType
EFh 5 33 6.6e-2 SMART
Blast:EFh 71 99 9e-6 BLAST
EFh 206 234 5.36e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Ahnak G T 19: 9,011,299 V3316F probably damaging Het
Cacna1a C T 8: 84,581,333 T1409I probably damaging Het
Ccdc158 A G 5: 92,643,807 M698T probably benign Het
Ces2g T A 8: 104,964,745 V171E probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dspp G A 5: 104,177,697 S642N unknown Het
Fezf2 A T 14: 12,343,986 C302S probably damaging Het
Gm10754 A G 10: 97,682,116 probably benign Het
Gm5581 G A 6: 131,167,068 noncoding transcript Het
Gm7929 T C 14: 41,750,552 K21E probably damaging Het
Hmcn1 A T 1: 150,722,369 D1727E probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Mrpl3 T C 9: 105,071,486 probably null Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Ncam1 T C 9: 49,564,995 I265V probably benign Het
Ncoa7 T C 10: 30,722,724 T68A probably benign Het
Oprk1 T C 1: 5,598,685 V118A probably benign Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sidt1 A G 16: 44,281,886 S304P possibly damaging Het
Srsf6 T A 2: 162,934,291 probably benign Het
Tas2r105 A G 6: 131,686,826 V213A probably benign Het
Tlr12 C T 4: 128,616,508 E650K probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trav4-2 T A 14: 53,418,830 D96E possibly damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vmn2r89 T C 14: 51,452,043 M1T probably null Het
Wdr20 A G 12: 110,793,516 T279A probably benign Het
Zfp407 A G 18: 84,559,596 S1131P possibly damaging Het
Zfyve1 A G 12: 83,594,522 V120A probably benign Het
Other mutations in Micu3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02970:Micu3 APN 8 40382130 missense possibly damaging 0.90
R0491:Micu3 UTSW 8 40366253 splice site probably benign
R1518:Micu3 UTSW 8 40335852 missense possibly damaging 0.94
R2089:Micu3 UTSW 8 40308372 missense probably benign 0.01
R3115:Micu3 UTSW 8 40382167 missense probably benign 0.21
R3893:Micu3 UTSW 8 40366224 missense probably damaging 1.00
R4094:Micu3 UTSW 8 40335888 missense probably null 1.00
R4595:Micu3 UTSW 8 40359397 intron probably benign
R4678:Micu3 UTSW 8 40380677 missense probably damaging 1.00
R5501:Micu3 UTSW 8 40354300 unclassified probably null
R6327:Micu3 UTSW 8 40366197 missense probably benign 0.13
R6793:Micu3 UTSW 8 40380695 missense probably damaging 0.99
R7292:Micu3 UTSW 8 40382125 missense probably benign 0.09
R7350:Micu3 UTSW 8 40348958 missense probably benign 0.09
R7427:Micu3 UTSW 8 40378914 missense possibly damaging 0.86
R7453:Micu3 UTSW 8 40335898 missense probably benign
R7635:Micu3 UTSW 8 40366234 missense possibly damaging 0.76
X0003:Micu3 UTSW 8 40366222 missense probably benign 0.00
Z1177:Micu3 UTSW 8 40308224 missense not run
Predicted Primers PCR Primer
(F):5'- GAGAATGTAGCATAATGATTTGCCC -3'
(R):5'- ATGTGGTGGTTGTTTACTCACACTTAC -3'

Sequencing Primer
(F):5'- GCATAATGATTTGCCCTTCCTAATTG -3'
(R):5'- CAAGAAATTCTGGCTTGATTGA -3'
Posted On2015-04-30