Incidental Mutation 'R4026:Wdr20'
ID312998
Institutional Source Beutler Lab
Gene Symbol Wdr20
Ensembl Gene ENSMUSG00000037957
Gene NameWD repeat domain 20
SynonymsWdr20a, 2310040A13Rik
MMRRC Submission 040849-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R4026 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location110737944-110804238 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110793516 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 279 (T279A)
Ref Sequence ENSEMBL: ENSMUSP00000093059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095410] [ENSMUST00000192870] [ENSMUST00000193053] [ENSMUST00000195886]
Predicted Effect probably benign
Transcript: ENSMUST00000095410
AA Change: T279A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000093059
Gene: ENSMUSG00000037957
AA Change: T279A

DomainStartEndE-ValueType
WD40 140 178 2.66e0 SMART
WD40 209 248 4.95e-4 SMART
WD40 251 290 1.47e-6 SMART
WD40 293 382 8.59e-1 SMART
Blast:WD40 464 559 2e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000192870
SMART Domains Protein: ENSMUSP00000141887
Gene: ENSMUSG00000037957

DomainStartEndE-ValueType
Blast:WD40 89 131 1e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193053
SMART Domains Protein: ENSMUSP00000141678
Gene: ENSMUSG00000037957

DomainStartEndE-ValueType
Blast:WD40 89 131 2e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194118
Predicted Effect probably benign
Transcript: ENSMUST00000195886
SMART Domains Protein: ENSMUSP00000142157
Gene: ENSMUSG00000037957

DomainStartEndE-ValueType
Blast:WD40 29 71 1e-16 BLAST
Meta Mutation Damage Score 0.1728 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein that functions to preserve and regulate the activity of the USP12-UAF1 deubiquitinating enzyme complex. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Ahnak G T 19: 9,011,299 V3316F probably damaging Het
Cacna1a C T 8: 84,581,333 T1409I probably damaging Het
Ccdc158 A G 5: 92,643,807 M698T probably benign Het
Ces2g T A 8: 104,964,745 V171E probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dspp G A 5: 104,177,697 S642N unknown Het
Fezf2 A T 14: 12,343,986 C302S probably damaging Het
Gm10754 A G 10: 97,682,116 probably benign Het
Gm5581 G A 6: 131,167,068 noncoding transcript Het
Gm7929 T C 14: 41,750,552 K21E probably damaging Het
Hmcn1 A T 1: 150,722,369 D1727E probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Micu3 A G 8: 40,359,455 probably benign Het
Mrpl3 T C 9: 105,071,486 probably null Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Ncam1 T C 9: 49,564,995 I265V probably benign Het
Ncoa7 T C 10: 30,722,724 T68A probably benign Het
Oprk1 T C 1: 5,598,685 V118A probably benign Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sidt1 A G 16: 44,281,886 S304P possibly damaging Het
Srsf6 T A 2: 162,934,291 probably benign Het
Tas2r105 A G 6: 131,686,826 V213A probably benign Het
Tlr12 C T 4: 128,616,508 E650K probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trav4-2 T A 14: 53,418,830 D96E possibly damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vmn2r89 T C 14: 51,452,043 M1T probably null Het
Zfp407 A G 18: 84,559,596 S1131P possibly damaging Het
Zfyve1 A G 12: 83,594,522 V120A probably benign Het
Other mutations in Wdr20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Wdr20 APN 12 110779449 nonsense probably null
IGL01663:Wdr20 APN 12 110793514 missense probably damaging 1.00
IGL02385:Wdr20 APN 12 110793223 missense probably benign
IGL02710:Wdr20 APN 12 110793110 splice site probably benign
IGL02993:Wdr20 APN 12 110794308 nonsense probably null
R1500:Wdr20 UTSW 12 110794030 missense probably benign
R1897:Wdr20 UTSW 12 110793723 missense probably benign
R2006:Wdr20 UTSW 12 110793568 missense probably damaging 1.00
R3615:Wdr20 UTSW 12 110793939 missense probably benign
R3616:Wdr20 UTSW 12 110793939 missense probably benign
R4023:Wdr20 UTSW 12 110793516 missense probably benign 0.01
R4157:Wdr20 UTSW 12 110738174 missense possibly damaging 0.68
R4868:Wdr20 UTSW 12 110738234 missense probably damaging 1.00
R6126:Wdr20 UTSW 12 110794102 missense probably benign
R6282:Wdr20 UTSW 12 110797009 unclassified probably benign
R6867:Wdr20 UTSW 12 110793699 missense probably benign
R7081:Wdr20 UTSW 12 110803450 missense possibly damaging 0.46
R7842:Wdr20 UTSW 12 110738215 missense probably benign 0.01
R7925:Wdr20 UTSW 12 110738215 missense probably benign 0.01
R8045:Wdr20 UTSW 12 110793319 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACCCTCTCCTTAAGTGGACG -3'
(R):5'- GCTCGATCTCTGCCAAAATGAAG -3'

Sequencing Primer
(F):5'- CTCCTTAAGTGGACGGTGGGC -3'
(R):5'- AGAAGGTCCTGGAAGTCCTC -3'
Posted On2015-04-30