Incidental Mutation 'R4026:Fezf2'
ID312999
Institutional Source Beutler Lab
Gene Symbol Fezf2
Ensembl Gene ENSMUSG00000021743
Gene NameFez family zinc finger 2
SynonymsFezl, Zfp312, forebrain embryonic zinc finger, Fez
MMRRC Submission 040849-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.872) question?
Stock #R4026 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location12342094-12348189 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12343986 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 302 (C302S)
Ref Sequence ENSEMBL: ENSMUSP00000153090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022262] [ENSMUST00000224023] [ENSMUST00000224714]
Predicted Effect probably damaging
Transcript: ENSMUST00000022262
AA Change: C302S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022262
Gene: ENSMUSG00000021743
AA Change: C302S

DomainStartEndE-ValueType
low complexity region 41 55 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
ZnF_C2H2 272 294 1.58e-3 SMART
ZnF_C2H2 300 322 3.39e-3 SMART
ZnF_C2H2 328 350 2.79e-4 SMART
ZnF_C2H2 356 378 2.57e-3 SMART
ZnF_C2H2 384 406 1.45e-2 SMART
ZnF_C2H2 412 435 1.92e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000224023
AA Change: C302S

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000224714
AA Change: C302S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.414 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show hyperactivity, altered feeding behavior leading to delayed growth and premature death, and impaired formation of subplate neurons and thalamocortical projections. Homozygotes for another allele lack a corpus callosum and show severe subcortical projection defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Ahnak G T 19: 9,011,299 V3316F probably damaging Het
Cacna1a C T 8: 84,581,333 T1409I probably damaging Het
Ccdc158 A G 5: 92,643,807 M698T probably benign Het
Ces2g T A 8: 104,964,745 V171E probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dspp G A 5: 104,177,697 S642N unknown Het
Gm10754 A G 10: 97,682,116 probably benign Het
Gm5581 G A 6: 131,167,068 noncoding transcript Het
Gm7929 T C 14: 41,750,552 K21E probably damaging Het
Hmcn1 A T 1: 150,722,369 D1727E probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Micu3 A G 8: 40,359,455 probably benign Het
Mrpl3 T C 9: 105,071,486 probably null Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Ncam1 T C 9: 49,564,995 I265V probably benign Het
Ncoa7 T C 10: 30,722,724 T68A probably benign Het
Oprk1 T C 1: 5,598,685 V118A probably benign Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sidt1 A G 16: 44,281,886 S304P possibly damaging Het
Srsf6 T A 2: 162,934,291 probably benign Het
Tas2r105 A G 6: 131,686,826 V213A probably benign Het
Tlr12 C T 4: 128,616,508 E650K probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trav4-2 T A 14: 53,418,830 D96E possibly damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vmn2r89 T C 14: 51,452,043 M1T probably null Het
Wdr20 A G 12: 110,793,516 T279A probably benign Het
Zfp407 A G 18: 84,559,596 S1131P possibly damaging Het
Zfyve1 A G 12: 83,594,522 V120A probably benign Het
Other mutations in Fezf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01895:Fezf2 APN 14 12342498 makesense probably null
IGL02008:Fezf2 APN 14 12343705 missense probably benign 0.01
IGL02238:Fezf2 APN 14 12344494 missense probably damaging 0.98
IGL02428:Fezf2 APN 14 12344494 missense probably damaging 0.98
IGL02588:Fezf2 APN 14 12343687 missense probably damaging 1.00
K3955:Fezf2 UTSW 14 12345097 missense probably damaging 1.00
R0266:Fezf2 UTSW 14 12342607 missense probably damaging 1.00
R0281:Fezf2 UTSW 14 12343977 missense probably damaging 1.00
R0849:Fezf2 UTSW 14 12342607 missense probably damaging 1.00
R1061:Fezf2 UTSW 14 12342713 missense probably damaging 1.00
R1107:Fezf2 UTSW 14 12342624 missense probably damaging 1.00
R1326:Fezf2 UTSW 14 12342644 missense probably benign 0.12
R1914:Fezf2 UTSW 14 12343988 missense probably damaging 1.00
R1955:Fezf2 UTSW 14 12342644 missense probably benign 0.12
R1980:Fezf2 UTSW 14 12344405 missense probably benign 0.04
R1981:Fezf2 UTSW 14 12344405 missense probably benign 0.04
R1982:Fezf2 UTSW 14 12344405 missense probably benign 0.04
R1988:Fezf2 UTSW 14 12344350 missense probably damaging 0.98
R4023:Fezf2 UTSW 14 12343986 missense probably damaging 1.00
R4025:Fezf2 UTSW 14 12343986 missense probably damaging 1.00
R5373:Fezf2 UTSW 14 12344803 missense possibly damaging 0.67
R6982:Fezf2 UTSW 14 12343645 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCGCACTGGTTACACTTATG -3'
(R):5'- ACTTGCTGGCTTCAGATGG -3'

Sequencing Primer
(F):5'- TTTCCTGCGAAGAGGGGC -3'
(R):5'- CTGGCTTCAGATGGGATGG -3'
Posted On2015-04-30