Mutagenetix > Incidental Mutation

Incidental Mutation 'R4026:Top2b'

313000

Institutional Source

Beutler Lab

Gene Symbol

Top2b

Ensembl Gene

ENSMUSG00000017485

Gene Name

topoisomerase (DNA) II beta

Synonyms

D230016L12Rik, Top-2

MMRRC Submission

040849-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.929) question?

Stock #

R4026 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

16365179-16435462 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 16409189 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 777 (I777M)

Ref Sequence

ENSEMBL: ENSMUSP00000017629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000161693]

AlphaFold

Q64511

Predicted Effect

probably damaging
Transcript: ENSMUST00000017629
AA Change: I777M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: I777M

Domain	Start	End	E-Value	Type
Blast:TOP2c	32	70	7e-10	BLAST
HATPase_c	85	234	1.91e-2	SMART
TOP2c	89	679	N/A	SMART
TOP4c	702	1175	2.55e-230	SMART
low complexity region	1201	1215	N/A	INTRINSIC
low complexity region	1287	1299	N/A	INTRINSIC
low complexity region	1324	1336	N/A	INTRINSIC
low complexity region	1360	1382	N/A	INTRINSIC
Pfam:DTHCT	1495	1597	4.6e-31	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159302

SMART Domains

Protein: ENSMUSP00000123789
Gene: ENSMUSG00000017485

Domain	Start	End	E-Value	Type
TOP4c	1	177	4.06e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160501

SMART Domains

Protein: ENSMUSP00000124889
Gene: ENSMUSG00000017485

Domain	Start	End	E-Value	Type
TOP4c	2	222	3.97e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161693

SMART Domains

Protein: ENSMUSP00000123992
Gene: ENSMUSG00000017485

Domain	Start	End	E-Value	Type
Pfam:DNA_topoisoIV	1	117	1.2e-12	PFAM
low complexity region	161	173	N/A	INTRINSIC
low complexity region	198	210	N/A	INTRINSIC
low complexity region	234	256	N/A	INTRINSIC

Meta Mutation Damage Score

0.8018

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.1%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg7	A	T	16: 56,730,298	Y684N	probably damaging	Het
Ahnak	G	T	19: 9,011,299	V3316F	probably damaging	Het
Cacna1a	C	T	8: 84,581,333	T1409I	probably damaging	Het
Ccdc158	A	G	5: 92,643,807	M698T	probably benign	Het
Ces2g	T	A	8: 104,964,745	V171E	probably damaging	Het
Ctnna2	A	T	6: 77,636,844	D254E	possibly damaging	Het
Dlec1	T	C	9: 119,137,340	Y1126H	probably damaging	Het
Dspp	G	A	5: 104,177,697	S642N	unknown	Het
Fezf2	A	T	14: 12,343,986	C302S	probably damaging	Het
Gm10754	A	G	10: 97,682,116		probably benign	Het
Gm5581	G	A	6: 131,167,068		noncoding transcript	Het
Gm7929	T	C	14: 41,750,552	K21E	probably damaging	Het
Hmcn1	A	T	1: 150,722,369	D1727E	probably benign	Het
Lrriq4	T	C	3: 30,650,273	V150A	possibly damaging	Het
Micu3	A	G	8: 40,359,455		probably benign	Het
Mrpl3	T	C	9: 105,071,486		probably null	Het
Myo1e	A	G	9: 70,324,875	I229V	probably benign	Het
Ncam1	T	C	9: 49,564,995	I265V	probably benign	Het
Ncoa7	T	C	10: 30,722,724	T68A	probably benign	Het
Oprk1	T	C	1: 5,598,685	V118A	probably benign	Het
Ppp3r1	T	C	11: 17,194,786	V133A	probably damaging	Het
Sidt1	A	G	16: 44,281,886	S304P	possibly damaging	Het
Srsf6	T	A	2: 162,934,291		probably benign	Het
Tas2r105	A	G	6: 131,686,826	V213A	probably benign	Het
Tlr12	C	T	4: 128,616,508	E650K	probably benign	Het
Trav4-2	T	A	14: 53,418,830	D96E	possibly damaging	Het
Vmn1r34	T	A	6: 66,637,704	M17L	probably benign	Het
Vmn2r6	A	T	3: 64,538,250	S685T	possibly damaging	Het
Vmn2r89	T	C	14: 51,452,043	M1T	probably null	Het
Wdr20	A	G	12: 110,793,516	T279A	probably benign	Het
Zfp407	A	G	18: 84,559,596	S1131P	possibly damaging	Het
Zfyve1	A	G	12: 83,594,522	V120A	probably benign	Het

Other mutations in Top2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Top2b	APN	14	16422692	missense	probably benign	0.00
IGL00730:Top2b	APN	14	16389831	missense	probably damaging	1.00
IGL00917:Top2b	APN	14	16407354	missense	probably benign	0.05
IGL01959:Top2b	APN	14	16422695	missense	probably benign	0.19
IGL02019:Top2b	APN	14	16409965	missense	probably benign	0.44
IGL02119:Top2b	APN	14	16406733	missense	probably damaging	1.00
IGL02136:Top2b	APN	14	16407103	unclassified	probably benign
IGL02148:Top2b	APN	14	16400488	missense	probably damaging	1.00
IGL02496:Top2b	APN	14	16387335	missense	probably benign
IGL02503:Top2b	APN	14	16407163	missense	possibly damaging	0.92
IGL02672:Top2b	APN	14	16409166	unclassified	probably benign
IGL02721:Top2b	APN	14	16409236	missense	probably damaging	1.00
IGL02886:Top2b	APN	14	16365688	missense	possibly damaging	0.73
IGL03252:Top2b	APN	14	16393163	missense	possibly damaging	0.60
PIT4434001:Top2b	UTSW	14	16423780	critical splice donor site	probably null
R0092:Top2b	UTSW	14	16409263	missense	probably damaging	1.00
R0201:Top2b	UTSW	14	16383174	missense	probably damaging	1.00
R0390:Top2b	UTSW	14	16418442	missense	probably benign	0.00
R0394:Top2b	UTSW	14	16413556	splice site	probably null
R1159:Top2b	UTSW	14	16430329	missense	possibly damaging	0.81
R1424:Top2b	UTSW	14	16383177	missense	probably damaging	1.00
R1519:Top2b	UTSW	14	16408953	splice site	probably null
R1561:Top2b	UTSW	14	16398993	missense	possibly damaging	0.80
R1713:Top2b	UTSW	14	16409823	missense	probably benign	0.05
R1987:Top2b	UTSW	14	16398916	missense	probably damaging	0.99
R2219:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2287:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2422:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2679:Top2b	UTSW	14	16413947	missense	probably damaging	1.00
R3687:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3707:Top2b	UTSW	14	16388447	missense	probably damaging	1.00
R3810:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3812:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3815:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3816:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3818:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4023:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4025:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4133:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4157:Top2b	UTSW	14	16384491	missense	probably benign	0.42
R4179:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4180:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4300:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4376:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4377:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4492:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4549:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4550:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4581:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4582:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4628:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4630:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4667:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4668:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4669:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4698:Top2b	UTSW	14	16387331	nonsense	probably null
R4769:Top2b	UTSW	14	16398991	missense	probably damaging	1.00
R4809:Top2b	UTSW	14	16383125	missense	probably benign	0.06
R4899:Top2b	UTSW	14	16387313	missense	probably damaging	1.00
R5035:Top2b	UTSW	14	16409966	missense	probably benign	0.01
R5621:Top2b	UTSW	14	16387280	missense	probably damaging	1.00
R5631:Top2b	UTSW	14	16409882	missense	probably damaging	1.00
R5685:Top2b	UTSW	14	16413666	missense	probably damaging	1.00
R5732:Top2b	UTSW	14	16400106	missense	possibly damaging	0.92
R5939:Top2b	UTSW	14	16422786	missense	probably damaging	0.96
R6007:Top2b	UTSW	14	16423779	critical splice donor site	probably null
R6087:Top2b	UTSW	14	16409864	missense	probably benign	0.14
R6144:Top2b	UTSW	14	16423740	missense	possibly damaging	0.48
R6196:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6218:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6229:Top2b	UTSW	14	16409838	missense	probably damaging	1.00
R6249:Top2b	UTSW	14	16399006	missense	probably damaging	1.00
R6337:Top2b	UTSW	14	16399026	missense	possibly damaging	0.77
R6353:Top2b	UTSW	14	16416671	missense	probably damaging	1.00
R6512:Top2b	UTSW	14	16409854	missense	possibly damaging	0.94
R6573:Top2b	UTSW	14	16398991	missense	probably damaging	1.00
R6614:Top2b	UTSW	14	16407142	nonsense	probably null
R6844:Top2b	UTSW	14	16429383	missense	possibly damaging	0.94
R6848:Top2b	UTSW	14	16409958	missense	possibly damaging	0.89
R6871:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6895:Top2b	UTSW	14	16413604	missense	probably benign	0.06
R7162:Top2b	UTSW	14	16416653	missense	probably benign	0.00
R7247:Top2b	UTSW	14	16416962	missense	probably benign	0.08
R7250:Top2b	UTSW	14	16420411	missense	probably benign
R7359:Top2b	UTSW	14	16407376	missense	probably null	1.00
R7365:Top2b	UTSW	14	16416649	missense	probably benign	0.04
R7493:Top2b	UTSW	14	16416605	missense	probably benign	0.00
R7528:Top2b	UTSW	14	16395427	nonsense	probably null
R7562:Top2b	UTSW	14	16412946	missense	probably benign	0.04
R7594:Top2b	UTSW	14	16428587	missense	probably benign
R7670:Top2b	UTSW	14	16416620	missense	possibly damaging	0.61
R7894:Top2b	UTSW	14	16413081	missense	possibly damaging	0.68
R8031:Top2b	UTSW	14	16412986	missense	probably damaging	0.98
R8150:Top2b	UTSW	14	16393291	missense	probably damaging	0.99
R8214:Top2b	UTSW	14	16383177	missense	probably damaging	1.00
R8299:Top2b	UTSW	14	16386123	missense	possibly damaging	0.68
R8977:Top2b	UTSW	14	16393239	missense	probably benign	0.36
R9562:Top2b	UTSW	14	16365718	missense	probably benign	0.09
R9565:Top2b	UTSW	14	16365718	missense	probably benign	0.09
R9798:Top2b	UTSW	14	16389845	missense	probably damaging	1.00
X0028:Top2b	UTSW	14	16384499	nonsense	probably null
Z1176:Top2b	UTSW	14	16395434	missense	probably damaging	1.00
Z1177:Top2b	UTSW	14	16416953	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CACCATGGAGAAGTAAGCACTG -3'
(R):5'- TGAAGTACTCTCCCTGAGCAG -3'

Sequencing Primer
(F):5'- GCACTGAAGATGGGATCAACTG -3'
(R):5'- TCTCCCTGAGCAGAAAAACTAAATG -3'

Posted On

2015-04-30