Incidental Mutation 'R4026:Vmn2r89'
ID313001
Institutional Source Beutler Lab
Gene Symbol Vmn2r89
Ensembl Gene ENSMUSG00000070448
Gene Namevomeronasal 2, receptor 89
SynonymsV2r10, V2r11
MMRRC Submission 040849-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R4026 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location51451962-51461293 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 51452043 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000124256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159611] [ENSMUST00000159734] [ENSMUST00000161670] [ENSMUST00000162998]
Predicted Effect probably null
Transcript: ENSMUST00000159611
AA Change: M1T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124065
Gene: ENSMUSG00000070448
AA Change: M1T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 449 4.8e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159734
AA Change: M1T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124256
Gene: ENSMUSG00000070448
AA Change: M1T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 420 1.1e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161670
AA Change: M1T

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124261
Gene: ENSMUSG00000070448
AA Change: M1T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162998
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

DomainStartEndE-ValueType
Pfam:Takusan 35 115 2.2e-25 PFAM
Meta Mutation Damage Score 0.618 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Ahnak G T 19: 9,011,299 V3316F probably damaging Het
Cacna1a C T 8: 84,581,333 T1409I probably damaging Het
Ccdc158 A G 5: 92,643,807 M698T probably benign Het
Ces2g T A 8: 104,964,745 V171E probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dspp G A 5: 104,177,697 S642N unknown Het
Fezf2 A T 14: 12,343,986 C302S probably damaging Het
Gm10754 A G 10: 97,682,116 probably benign Het
Gm5581 G A 6: 131,167,068 noncoding transcript Het
Gm7929 T C 14: 41,750,552 K21E probably damaging Het
Hmcn1 A T 1: 150,722,369 D1727E probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Micu3 A G 8: 40,359,455 probably benign Het
Mrpl3 T C 9: 105,071,486 probably null Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Ncam1 T C 9: 49,564,995 I265V probably benign Het
Ncoa7 T C 10: 30,722,724 T68A probably benign Het
Oprk1 T C 1: 5,598,685 V118A probably benign Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sidt1 A G 16: 44,281,886 S304P possibly damaging Het
Srsf6 T A 2: 162,934,291 probably benign Het
Tas2r105 A G 6: 131,686,826 V213A probably benign Het
Tlr12 C T 4: 128,616,508 E650K probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trav4-2 T A 14: 53,418,830 D96E possibly damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Wdr20 A G 12: 110,793,516 T279A probably benign Het
Zfp407 A G 18: 84,559,596 S1131P possibly damaging Het
Zfyve1 A G 12: 83,594,522 V120A probably benign Het
Other mutations in Vmn2r89
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Vmn2r89 APN 14 51454965 missense probably damaging 1.00
IGL00990:Vmn2r89 APN 14 51455971 missense probably benign 0.14
IGL00990:Vmn2r89 APN 14 51457493 missense probably benign
IGL01991:Vmn2r89 APN 14 51452219 missense probably benign 0.00
IGL03073:Vmn2r89 APN 14 51456071 missense possibly damaging 0.95
IGL03085:Vmn2r89 APN 14 51452158 missense probably damaging 0.99
IGL03278:Vmn2r89 APN 14 51455100 missense probably damaging 0.99
R0115:Vmn2r89 UTSW 14 51456120 missense probably damaging 1.00
R0127:Vmn2r89 UTSW 14 51455703 missense probably damaging 0.98
R0391:Vmn2r89 UTSW 14 51455978 missense probably damaging 0.99
R0481:Vmn2r89 UTSW 14 51456120 missense probably damaging 1.00
R0538:Vmn2r89 UTSW 14 51457591 splice site probably null
R1210:Vmn2r89 UTSW 14 51454970 missense probably benign 0.01
R1332:Vmn2r89 UTSW 14 51455102 missense probably benign 0.00
R1660:Vmn2r89 UTSW 14 51456236 missense possibly damaging 0.48
R1959:Vmn2r89 UTSW 14 51457440 missense probably benign 0.22
R2876:Vmn2r89 UTSW 14 51455084 missense possibly damaging 0.47
R3410:Vmn2r89 UTSW 14 51456171 missense probably damaging 0.98
R4398:Vmn2r89 UTSW 14 51452094 missense probably damaging 1.00
R4700:Vmn2r89 UTSW 14 51457485 missense probably damaging 1.00
R4714:Vmn2r89 UTSW 14 51452231 missense probably damaging 0.97
R5162:Vmn2r89 UTSW 14 51456163 missense possibly damaging 0.88
R5294:Vmn2r89 UTSW 14 51455113 missense probably benign 0.00
R5811:Vmn2r89 UTSW 14 51456108 missense probably benign 0.12
R6087:Vmn2r89 UTSW 14 51457576 synonymous probably null
R6229:Vmn2r89 UTSW 14 51455721 missense probably benign 0.05
R6246:Vmn2r89 UTSW 14 51456046 missense probably damaging 1.00
R6572:Vmn2r89 UTSW 14 51455993 missense probably damaging 1.00
R7351:Vmn2r89 UTSW 14 51456282 missense probably benign 0.30
X0019:Vmn2r89 UTSW 14 51456415 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCCTATGTATCTAGGGAGCATGAC -3'
(R):5'- CTCACTAATGACATTGACACAGG -3'

Sequencing Primer
(F):5'- TATGTATCTAGGGAGCATGACATAGG -3'
(R):5'- TGCAAATCTCCATCACTATC -3'
Posted On2015-04-30